Morpholino

MO2-foxi1

ID
ZDB-MRPHLNO-061106-7
Name
MO2-foxi1
Previous Names
  • foxi1-MO (1)
Target
Sequence
5' - TAATCCGCTCTCCCTCCAGAAACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxi1
Phenotype
Phenotype resulting from MO2-foxi1
Phenotype Fish Figures
adenohypophyseal placode increased size, abnormal x24Tg + MO2-foxi1 + MO2-gata3 Fig. 4 with image from Bhat et al., 2013
dorsolateral placode hmx3a expression decreased distribution, abnormal TU + MO2-foxi1 Fig. 6 with image from Yao et al., 2014
dorsolateral placode dlx3b expression decreased distribution, abnormal TU + MO2-foxi1 Fig. 6 with image from Yao et al., 2014
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-foxi1 Fig. 1 with image from Solomon et al., 2003
epibranchial field sox3 expression absent, abnormal WT + MO2-foxi1 Fig. 7 with image from Sun et al., 2007
epibranchial field pax2a expression absent, abnormal WT + MO2-foxi1 Fig. 7 with image from Sun et al., 2007
epibranchial field sox3 expression decreased distribution, abnormal TU + MO2-foxi1 Fig. 6 with image from Yao et al., 2014
facial ganglion absent, abnormal rw0Tg + MO2-foxi1 Fig. 2 with image from Lee et al., 2003
glossopharyngeal ganglion absent, abnormal rw0Tg + MO2-foxi1 Fig. 2 with image from Lee et al., 2003
mandibular arch skeleton decreased size, abnormal WT + MO2-foxi1 Fig. 1 with image from Solomon et al., 2003
neurogenic field posterior region six4b expression decreased amount, abnormal TU + MO2-foxi1 Fig. 6 with image from Yao et al., 2014
olfactory pit increased size, abnormal x24Tg + MO2-foxi1 + MO2-gata3 Fig. 4 with image from Bhat et al., 2013
otic placode pax2a expression decreased distribution, abnormal TU + MO2-foxi1 Fig. 6 with image from Yao et al., 2014
otic vesicle hmx3a expression decreased distribution, abnormal TU + MO2-foxi1 Fig. 6 with image from Yao et al., 2014
otic vesicle decreased size, abnormal WT + MO2-foxi1 Fig. 7 with image from Hans et al., 2007
Fig. 1 with image from Solomon et al., 2003
otic vesicle hypoplastic, abnormal x24Tg + MO2-foxi1 + MO2-gata3 Fig. 4 with image from Bhat et al., 2013
otic vesicle development disrupted, abnormal WT + MO2-foxi1 Fig. 1 with image from Solomon et al., 2003
pharyngeal endoderm apoptotic, abnormal AB + MO2-foxi1 Fig. 9 with image from Edlund et al., 2014
vagal ganglion decreased size, abnormal rw0Tg + MO2-foxi1 Fig. 2 with image from Lee et al., 2003
vagal ganglion lacks parts or has fewer parts of type vagal ganglion, abnormal rw0Tg + MO2-foxi1 Fig. 2 with image from Lee et al., 2003
whole organism bmper expression decreased amount, abnormal TU + MO2-foxi1 Fig. 7 with image from Yao et al., 2014
whole organism dlx3b expression decreased amount, abnormal TU + MO2-foxi1 Fig. 7 with image from Yao et al., 2014
Phenotype of all Fish created by or utilizing MO2-foxi1
Phenotype Fish Conditions Figures
pharyngeal endoderm apoptotic, abnormal AB + MO2-foxi1 heat shock Fig. 9 with image from Edlund et al., 2014
pharyngeal endoderm apoptotic, abnormal AB + MO2-foxi1 standard conditions Fig. 9 with image from Edlund et al., 2014
dorsolateral placode hmx3a expression decreased distribution, abnormal TU + MO2-foxi1 control Fig. 6 with image from Yao et al., 2014
epibranchial field sox3 expression decreased distribution, abnormal TU + MO2-foxi1 control Fig. 6 with image from Yao et al., 2014
otic placode pax2a expression decreased distribution, abnormal TU + MO2-foxi1 control Fig. 6 with image from Yao et al., 2014
neurogenic field posterior region six4b expression decreased amount, abnormal TU + MO2-foxi1 control Fig. 6 with image from Yao et al., 2014
epibranchial field sox3 expression spatial pattern, ameliorated TU + MO2-foxi1 chemical treatment: Wnt signalling activator Fig. 5 with image from Yao et al., 2014
whole organism bmper expression decreased amount, abnormal TU + MO2-foxi1 control Fig. 7 with image from Yao et al., 2014
otic vesicle hmx3a expression decreased distribution, abnormal TU + MO2-foxi1 control Fig. 6 with image from Yao et al., 2014
otic placode pax2a expression spatial pattern, ameliorated TU + MO2-foxi1 chemical treatment: Wnt signalling activator Fig. 5 with image from Yao et al., 2014
dorsolateral placode dlx3b expression decreased distribution, abnormal TU + MO2-foxi1 control Fig. 6 with image from Yao et al., 2014
whole organism dlx3b expression decreased amount, abnormal TU + MO2-foxi1 control Fig. 7 with image from Yao et al., 2014
mandibular arch skeleton decreased size, abnormal WT + MO2-foxi1 standard conditions Fig. 1 with image from Solomon et al., 2003
otic vesicle development disrupted, abnormal WT + MO2-foxi1 standard conditions Fig. 1 with image from Solomon et al., 2003
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-foxi1 standard conditions Fig. 1 with image from Solomon et al., 2003
epibranchial field pax2a expression absent, abnormal WT + MO2-foxi1 standard conditions Fig. 7 with image from Sun et al., 2007
otic vesicle decreased size, abnormal WT + MO2-foxi1 standard conditions Fig. 7 with image from Hans et al., 2007
Fig. 1 with image from Solomon et al., 2003
epibranchial field sox3 expression absent, abnormal WT + MO2-foxi1 standard conditions Fig. 7 with image from Sun et al., 2007
vagal ganglion lacks parts or has fewer parts of type vagal ganglion, abnormal rw0Tg + MO2-foxi1 standard conditions Fig. 2 with image from Lee et al., 2003
facial ganglion absent, abnormal rw0Tg + MO2-foxi1 standard conditions Fig. 2 with image from Lee et al., 2003
glossopharyngeal ganglion absent, abnormal rw0Tg + MO2-foxi1 standard conditions Fig. 2 with image from Lee et al., 2003
vagal ganglion decreased size, abnormal rw0Tg + MO2-foxi1 standard conditions Fig. 2 with image from Lee et al., 2003
otic vesicle aplastic, abnormal WT + MO1-dlx3b + MO2-foxi1 standard conditions Fig. 7 with image from Hans et al., 2007
otic vesicle hypoplastic, abnormal WT + MO1-dlx3b + MO2-foxi1 standard conditions Fig. 1 with image from Bhat et al., 2013
trigeminal placode hypoplastic, abnormal WT + MO2-foxi1 + MO2-gata3 standard conditions Fig. 4 with image from Bhat et al., 2013
otic placode hypoplastic, abnormal WT + MO2-foxi1 + MO2-gata3 standard conditions Fig. 4 with image from Bhat et al., 2013
lens morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
olfactory pit morphology, abnormal WT + MO2-foxi1 + MO2-gata3 + MO2-tfap2c + MO4-tfap2a standard conditions Fig. 4 with image from Kwon et al., 2010
otic vesicle neurogenesis decreased process quality, abnormal Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO2-foxi1 standard conditions Fig. 4 with image from Hans et al., 2013
otic vesicle malformed, abnormal Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO2-foxi1 standard conditions Fig. 4 with image from Hans et al., 2013
otic vesicle morphogenesis decreased process quality, abnormal Df(Chr12:dlx3b,dlx4b,tbx6)b380/b380 + MO2-foxi1 standard conditions Fig. 4 with image from Hans et al., 2013
otic vesicle decreased size, abnormal b1193Tg + MO2-foxi1 (AB) heat shock Fig. 7 with image from Hans et al., 2007
adenohypophyseal placode increased size, abnormal x24Tg + MO2-foxi1 + MO2-gata3 heat shock Fig. 4 with image from Bhat et al., 2013
olfactory pit increased size, abnormal x24Tg + MO2-foxi1 + MO2-gata3 heat shock Fig. 4 with image from Bhat et al., 2013
otic vesicle hypoplastic, abnormal x24Tg + MO2-foxi1 + MO2-gata3 heat shock Fig. 4 with image from Bhat et al., 2013
otic vesicle aplastic, abnormal b1193Tg + MO1-dlx3b + MO2-foxi1 (AB) heat shock Fig. 7 with image from Hans et al., 2007
Citations