Morpholino

MO2-admp

ID
ZDB-MRPHLNO-110902-1
Name
MO2-admp
Previous Names
None
Target
Sequence
5' - TGGACAACATTGTAAAGAACATTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Contains a mismatch to prevent self-hybridization.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-admp
Expressed Gene Anatomy Figures
pnhd Fig. 3 from Yan et al., 2019
Phenotype
Phenotype resulting from MO2-admp
Phenotype Fish Figures
determination of ventral identity disrupted, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
margin anterior region pnhd expression increased distribution, abnormal TU + MO2-admp Fig. 3 from Yan et al., 2019
notochord increased width, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
regionalization disrupted, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
shield increased size, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
trunk decreased size, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
trunk morphology, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
whole organism EGFP expression decreased amount, abnormal pt510Tg + MO2-admp Fig. 4 from Yan et al., 2019
whole organism lacks parts or has fewer parts of type post-vent region, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
whole organism morphology, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
whole organism wholly dorsalized, abnormal WT + MO2-admp Fig. 2 with image from Lele et al., 2001
Phenotype of all Fish created by or utilizing MO2-admp
Phenotype Fish Conditions Figures
margin anterior region pnhd expression increased distribution, abnormal TU + MO2-admp standard conditions Fig. 3 from Yan et al., 2019
shield increased size, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
trunk decreased size, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
determination of ventral identity disrupted, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
trunk morphology, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
notochord increased width, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
whole organism morphology, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
whole organism lacks parts or has fewer parts of type post-vent region, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
regionalization disrupted, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
whole organism wholly dorsalized, abnormal WT + MO2-admp standard conditions Fig. 2 with image from Lele et al., 2001
whole organism EGFP expression decreased amount, abnormal pt510Tg + MO2-admp standard conditions Fig. 4 from Yan et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.