Morpholino

MO1-npc1

ID
ZDB-MRPHLNO-110810-1
Name
MO1-npc1
Previous Names
None
Target
Sequence
5' - TGTGGTTTCTCCCCAGCAGAAGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-npc1
Phenotype
Phenotype resulting from MO1-npc1
Phenotype Fish Figures
actin cytoskeleton organization disrupted, abnormal WT + MO1-npc1 Fig. 7 from Schwend et al., 2011
blood island thrombocyte absent, abnormal la2Tg + MO1-npc1 Fig. 5 from Louwette et al., 2013
blood island thrombocyte decreased amount, abnormal la2Tg + MO1-npc1 Fig. 5 from Louwette et al., 2013
brain morphology, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
cell death increased occurrence, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
cerebellum cholesterol increased amount, abnormal AB/TL + MO1-npc1 Fig. 3 with image from Cook et al., 2020
cerebellum ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 Fig. 4 with image from Cook et al., 2020
cholesterol transport process quality, abnormal WT + MO1-npc1 Fig. 1 from Schwend et al., 2011
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-npc1 Fig. 3Fig. 4Fig. 6Fig. 8 from Schwend et al., 2011
eye morphology, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
forebrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 Fig. 3 with image from Cook et al., 2020
forebrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 Fig. 4 with image from Cook et al., 2020
hatching decreased rate, abnormal WT + MO1-npc1 Fig. 5 from Liao et al., 2018
head malformed, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
hindbrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 Fig. 3 with image from Cook et al., 2020
hindbrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 Fig. 4 with image from Cook et al., 2020
intracellular cholesterol transport disrupted, abnormal WT + MO1-npc1 Fig. 7 with image from Chu et al., 2015
lateral mesoderm increased width, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
midbrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 Fig. 3 with image from Cook et al., 2020
midbrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 Fig. 4 with image from Cook et al., 2020
notochord increased width, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-npc1 Fig. 5 from Louwette et al., 2013
programmed cell death increased occurrence, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
regulation of cholesterol storage disrupted, abnormal WT + MO1-npc1 Fig. 4 from Louwette et al., 2013
segmental plate increased width, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
trunk sterol spatial pattern, abnormal WT + MO1-npc1 Fig. 1 from Schwend et al., 2011
whole organism dead, abnormal la2Tg + MO1-npc1 Fig. 5 from Louwette et al., 2013
whole organism decreased length, abnormal WT + MO1-npc1 Fig. 9 from Schwend et al., 2011
whole organism viability, abnormal WT + MO1-npc1 text only from Schwend et al., 2011
whole organism cholesterol increased amount, abnormal WT + MO1-npc1 Fig. 5 from Liao et al., 2018
Fig. 7 with image from Chu et al., 2015
whole organism motor behavior decreased process quality, abnormal AB/TL + MO1-npc1 Fig. 1 with image from Cook et al., 2020
Phenotype of all Fish created by or utilizing MO1-npc1
Phenotype Fish Conditions Figures
midbrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 control Fig. 4 with image from Cook et al., 2020
cerebellum ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 control Fig. 4 with image from Cook et al., 2020
midbrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 control Fig. 3 with image from Cook et al., 2020
cerebellum cholesterol increased amount, abnormal AB/TL + MO1-npc1 control Fig. 3 with image from Cook et al., 2020
forebrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 control Fig. 3 with image from Cook et al., 2020
forebrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 control Fig. 4 with image from Cook et al., 2020
whole organism motor behavior decreased process quality, abnormal AB/TL + MO1-npc1 control Fig. 1 with image from Cook et al., 2020
hindbrain ganglioside GM1 increased amount, abnormal AB/TL + MO1-npc1 control Fig. 4 with image from Cook et al., 2020
hindbrain cholesterol increased amount, abnormal AB/TL + MO1-npc1 control Fig. 3 with image from Cook et al., 2020
segmental plate increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
intracellular cholesterol transport disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 7 with image from Chu et al., 2015
eye morphology, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
brain morphology, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
whole organism cholesterol increased amount, abnormal WT + MO1-npc1 standard conditions Fig. 5 from Liao et al., 2018
Fig. 7 with image from Chu et al., 2015
epiboly involved in gastrulation with mouth forming second onset quality, ameliorated WT + MO1-npc1 chemical treatment by environment: pregnenolone Fig. 8 from Schwend et al., 2011
trunk sterol spatial pattern, abnormal WT + MO1-npc1 standard conditions Fig. 1 from Schwend et al., 2011
epiboly involved in gastrulation with mouth forming second onset quality, ameliorated WT + MO1-npc1 chemical treatment by environment: dexamethasone Fig. 8 from Schwend et al., 2011
whole organism viability, abnormal WT + MO1-npc1 standard conditions text only from Schwend et al., 2011
programmed cell death increased occurrence, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
cell death increased occurrence, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
lateral mesoderm increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
notochord increased width, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
head malformed, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
regulation of cholesterol storage disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 4 from Louwette et al., 2013
cholesterol transport process quality, abnormal WT + MO1-npc1 standard conditions Fig. 1 from Schwend et al., 2011
hatching decreased rate, abnormal WT + MO1-npc1 standard conditions Fig. 5 from Liao et al., 2018
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-npc1 standard conditions Fig. 3Fig. 4Fig. 6Fig. 8 from Schwend et al., 2011
whole organism decreased length, abnormal WT + MO1-npc1 standard conditions Fig. 9 from Schwend et al., 2011
actin cytoskeleton organization disrupted, abnormal WT + MO1-npc1 standard conditions Fig. 7 from Schwend et al., 2011
blood island thrombocyte absent, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
whole organism dead, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
blood island thrombocyte decreased amount, abnormal la2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-npc1 standard conditions Fig. 5 from Louwette et al., 2013
Citations