Morpholino

MO1-gbx2

ID
ZDB-MRPHLNO-110324-1
Name
MO1-gbx2
Previous Names
None
Target
Sequence
5' - ACGGTGTGCTGAAAGCTGCACTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gbx2
Expressed Gene Anatomy Figures
aox5 Fig. 3 from Hozumi et al., 2018
dct Fig. 3 from Hozumi et al., 2018
foxd3 Fig. 3 from Hozumi et al., 2018
gbx1 Fig. 2 with image from Burroughs-Garcia et al., 2011
hoxa2b Fig. 1 with image from Burroughs-Garcia et al., 2011
ltk Fig. 3 from Hozumi et al., 2018
mitfa Fig. 3 from Hozumi et al., 2018
pnp4a Fig. 3 from Hozumi et al., 2018
Phenotype
Phenotype resulting from MO1-gbx2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal ba2Tg + MO1-gbx2 Fig. 3 from Hozumi et al., 2018
cell proliferation in forebrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 Fig. 3 with image from Burroughs-Garcia et al., 2011
cell proliferation in hindbrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 Fig. 3 with image from Burroughs-Garcia et al., 2011
cranial nerve V motor neuron disorganized, abnormal rw0Tg + MO1-gbx2 Fig. 1 with image,  Fig. 4 with image from Burroughs-Garcia et al., 2011
cranial nerve V neuronal cell body position, abnormal rw0Tg + MO1-gbx2 Fig. 5 with image from Burroughs-Garcia et al., 2011
hindbrain anterior region truncated, abnormal WT + MO1-gbx2 Fig. 1 with image,  Fig. 4 with image from Burroughs-Garcia et al., 2011
hindbrain development disrupted, abnormal rw0Tg + MO1-gbx2 Fig. 1 with image from Burroughs-Garcia et al., 2011
iridoblast ltk expression absent, abnormal WT + MO1-gbx2 Fig. 3 from Hozumi et al., 2018
iridophore pnp4a expression absent, abnormal WT + MO1-gbx2 Fig. 3 from Hozumi et al., 2018
rhombomere 2 apoptotic, abnormal WT + MO1-gbx2 Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 3 apoptotic, abnormal WT + MO1-gbx2 Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 3 decreased width, abnormal rw0Tg + MO1-gbx2 Fig. 1 with image from Burroughs-Garcia et al., 2011
rhombomere 4 apoptotic, abnormal WT + MO1-gbx2 Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 5 apoptotic, abnormal WT + MO1-gbx2 Fig. 4 with image from Burroughs-Garcia et al., 2011
whole organism has fewer parts of type iridophore, abnormal WT + MO1-gbx2 Fig. 1 from Hozumi et al., 2018
Phenotype of all Fish created by or utilizing MO1-gbx2
Phenotype Fish Conditions Figures
rhombomere 3 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
hindbrain anterior region truncated, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
iridoblast ltk expression absent, abnormal WT + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
iridophore pnp4a expression absent, abnormal WT + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
rhombomere 2 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 5 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 4 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
whole organism has fewer parts of type iridophore, abnormal WT + MO1-gbx2 standard conditions Fig. 1 from Hozumi et al., 2018
apoptotic process increased occurrence, abnormal ba2Tg + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
hindbrain development disrupted, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
hindbrain anterior region truncated, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
cranial nerve V neuronal cell body position, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 5 with image from Burroughs-Garcia et al., 2011
cell proliferation in hindbrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 3 with image from Burroughs-Garcia et al., 2011
cranial nerve V motor neuron disorganized, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image,  Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 3 decreased width, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
cell proliferation in forebrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 3 with image from Burroughs-Garcia et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.