Morpholino

MO2-cftr

ID
ZDB-MRPHLNO-101104-2
Name
MO2-cftr
Previous Names
  • CFTR Trans MO (1)
Target
Sequence
5' - CATCCTCCACAGGTGATCTCTGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cftr
Expressed Gene Anatomy Figures
cdx4 Fig. S12 with image from Sun et al., 2018
drl Fig. S4 with image from Sun et al., 2018
fli1 Fig. S10 with image from Sun et al., 2018
gata1a Fig. S6 with image,  Fig. S10 with image,  Fig. S14 with image from Sun et al., 2018
gata2a Fig. S10 with image from Sun et al., 2018
hbbe3 Fig. S10 with image from Sun et al., 2018
hoxa9a Fig. S12 with image from Sun et al., 2018
lcp1 Fig. S6 with image from Sun et al., 2018
lef1 Fig. 3 with image from Sun et al., 2018
lmo2 Fig. S10 with image from Sun et al., 2018
myb Fig. S10 with image from Sun et al., 2018
myca Fig. 3 with image from Sun et al., 2018
runx1 Fig. S10 with image from Sun et al., 2018
spi1b Fig. S10 with image from Sun et al., 2018
tal1 Fig. S6 with image,  Fig. S7 with image,  Fig. S10 with image,  Fig. S14 with image from Sun et al., 2018
Phenotype
Phenotype resulting from MO2-cftr
Phenotype Fish Figures
common myeloid progenitor tal1 expression decreased amount, abnormal AB + MO2-cftr Fig. S6 with image from Sun et al., 2018
common myeloid progenitor myb expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
common myeloid progenitor runx1 expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
erythroid lineage cell hbbe3 expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
erythroid lineage cell gata1a expression decreased amount, abnormal AB + MO2-cftr Fig. S6 with image from Sun et al., 2018
intermediate cell mass of mesoderm runx1 expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
intermediate cell mass of mesoderm hbbe3 expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
intermediate cell mass of mesoderm myb expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
lateral plate mesoderm lmo2 expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
lateral plate mesoderm tal1 expression decreased amount, abnormal AB + MO2-cftr Fig. S7 with image,  Fig. S10 with image,  Fig. S14 with image from Sun et al., 2018
lateral plate mesoderm gata2a expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
lateral plate mesoderm gata1a expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image,  Fig. S14 with image from Sun et al., 2018
mesoderm cdx4 expression decreased amount, abnormal AB + MO2-cftr Fig. S12 with image from Sun et al., 2018
mesoderm hoxa9a expression decreased amount, abnormal AB + MO2-cftr Fig. S12 with image from Sun et al., 2018
myeloid cell lcp1 expression decreased amount, abnormal AB + MO2-cftr Fig. S6 with image from Sun et al., 2018
myeloid lineage restricted progenitor cell spi1b expression decreased amount, abnormal AB + MO2-cftr Fig. S10 with image from Sun et al., 2018
whole organism lef1 expression decreased amount, abnormal AB + MO2-cftr Fig. 3 with image from Sun et al., 2018
whole organism myca expression decreased amount, abnormal AB + MO2-cftr Fig. 3 with image from Sun et al., 2018
Phenotype of all Fish created by or utilizing MO2-cftr
Phenotype Fish Conditions Figures
whole organism il1b expression amount, ameliorated AB + MO1-cftr + MO2-cftr viral treatment by injection: Pseudomonas phage vB_PaeM_E215, viral treatment by injection: Pseudomonas phage vB_PaeM_E217, viral treatment by injection: Pseudomonas phage vB_PaeP_PYO2, viral treatment by injection: Pseudomonas phage vB_PaeP_DEV Fig. 4 from Cafora et al., 2019
whole organism decreased life span, ameliorated AB + MO1-cftr + MO2-cftr viral treatment by injection: Pseudomonas phage vB_PaeM_E215, viral treatment by injection: Pseudomonas phage vB_PaeM_E217, bacterial treatment by injection: Pseudomonas aeruginosa, viral treatment by injection: Pseudomonas phage vB_PaeP_DEV, viral treatment by injection: Pseudomonas phage vB_PaeP_PYO2, chemical treatment: ciprofloxacin Fig. 5 from Cafora et al., 2019
whole organism tnfa expression increased amount, abnormal AB + MO1-cftr + MO2-cftr control Fig. 4 from Cafora et al., 2019
heart looping disrupted, abnormal AB + MO1-cftr + MO2-cftr standard conditions Fig. 1 from Cafora et al., 2020
defense response to bacterium decreased efficacy, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image,  Fig. 3 with image from Cafora et al., 2019
defense response to bacterium decreased efficacy, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 4 from Cafora et al., 2020
whole organism tnfa expression increased amount, abnormal AB + MO1-cftr + MO2-cftr viral treatment by injection: Pseudomonas phage vB_PaeM_E215, viral treatment by injection: Pseudomonas phage vB_PaeM_E217, bacterial treatment by injection: Pseudomonas aeruginosa, viral treatment by injection: Pseudomonas phage vB_PaeP_DEV, viral treatment by injection: Pseudomonas phage vB_PaeP_PYO2 Fig. 3 with image from Cafora et al., 2019
defense response to bacterium increased efficacy, abnormal AB + MO1-cftr + MO2-cftr viral treatment by injection: Pseudomonas phage vB_PaeM_E215, viral treatment by injection: Pseudomonas phage vB_PaeM_E217, bacterial treatment by injection: Pseudomonas aeruginosa, viral treatment by injection: Pseudomonas phage vB_PaeP_DEV, viral treatment by injection: Pseudomonas phage vB_PaeP_PYO2 Fig. 3 with image from Cafora et al., 2019
heart looping decreased occurrence, abnormal AB + MO1-cftr + MO2-cftr control Fig. 2 with image from Cafora et al., 2019
whole organism decreased life span, ameliorated AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa, chemical treatment: ciprofloxacin Fig. 5 from Cafora et al., 2019
whole organism decreased life span, ameliorated AB + MO1-cftr + MO2-cftr viral treatment by injection: Pseudomonas phage vB_PaeM_E215, viral treatment by injection: Pseudomonas phage vB_PaeM_E217, bacterial treatment by injection: Pseudomonas aeruginosa, viral treatment by injection: Pseudomonas phage vB_PaeP_DEV, viral treatment by injection: Pseudomonas phage vB_PaeP_PYO2 Fig. 3 with image,  Fig. 5 from Cafora et al., 2019
whole organism il1b expression decreased amount, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image from Cafora et al., 2019
whole organism decreased life span, exacerbated AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 3 with image from Cafora et al., 2019
heart mislocalised, abnormal AB + MO1-cftr + MO2-cftr standard conditions Fig. 1 from Cafora et al., 2020
whole organism il1b expression increased amount, abnormal AB + MO1-cftr + MO2-cftr control Fig. 4 from Cafora et al., 2019
whole organism tnfa expression amount, ameliorated AB + MO1-cftr + MO2-cftr viral treatment by injection: Pseudomonas phage vB_PaeM_E215, viral treatment by injection: Pseudomonas phage vB_PaeM_E217, viral treatment by injection: Pseudomonas phage vB_PaeP_PYO2, viral treatment by injection: Pseudomonas phage vB_PaeP_DEV Fig. 4 from Cafora et al., 2019
whole organism tnfa expression increased amount, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 3 with image from Cafora et al., 2019
whole organism il1b expression increased amount, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 3 with image from Cafora et al., 2019
whole organism dead, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 3 from Cafora et al., 2020
defense response to bacterium disrupted, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment: Pseudomonas aeruginosa PA14 Fig. 4 from Phennicie et al., 2010
respiratory burst involved in inflammatory response disrupted, abnormal AB + MO1-cftr + MO2-cftr standard conditions Fig. 2 from Phennicie et al., 2010
whole organism decreased life span, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 3 from Cafora et al., 2020
whole organism tnfa expression increased amount, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 5 from Cafora et al., 2020
whole organism il1b expression amount, ameliorated AB + MO1-cftr + MO2-cftr viral treatment by injection: Pseudomonas phage vB_PaeM_E215, viral treatment by injection: Pseudomonas phage vB_PaeM_E217, bacterial treatment by injection: Pseudomonas aeruginosa, viral treatment by injection: Pseudomonas phage vB_PaeP_DEV, viral treatment by injection: Pseudomonas phage vB_PaeP_PYO2 Fig. 3 with image from Cafora et al., 2019
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO1-cftr + MO2-cftr standard conditions Fig. 1 from Cafora et al., 2020
determination of pancreatic left/right asymmetry decreased occurrence, abnormal AB + MO1-cftr + MO2-cftr control Fig. 2 with image from Cafora et al., 2019
whole organism tnfa expression decreased amount, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 2 with image from Cafora et al., 2019
whole organism decreased life span, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 5 from Cafora et al., 2019
determination of liver left/right asymmetry disrupted, abnormal AB + MO1-cftr + MO2-cftr standard conditions Fig. 1 from Cafora et al., 2020
whole organism il1b expression increased amount, abnormal AB + MO1-cftr + MO2-cftr bacterial treatment by injection: Pseudomonas aeruginosa Fig. 5 from Cafora et al., 2020
determination of liver left/right asymmetry decreased occurrence, abnormal AB + MO1-cftr + MO2-cftr control Fig. 2 with image from Cafora et al., 2019
myeloid lineage restricted progenitor cell spi1b expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
lateral plate mesoderm lmo2 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
mesoderm cdx4 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S12 with image from Sun et al., 2018
common myeloid progenitor runx1 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
common myeloid progenitor tal1 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S6 with image from Sun et al., 2018
lateral plate mesoderm gata2a expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
lateral plate mesoderm tal1 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S7 with image,  Fig. S10 with image,  Fig. S14 with image from Sun et al., 2018
mesoderm hoxa9a expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S12 with image from Sun et al., 2018
intermediate cell mass of mesoderm hbbe3 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
intermediate cell mass of mesoderm myb expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
intermediate cell mass of mesoderm runx1 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
erythroid lineage cell hbbe3 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
whole organism myca expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. 3 with image from Sun et al., 2018
erythroid lineage cell gata1a expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S6 with image from Sun et al., 2018
whole organism lef1 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. 3 with image from Sun et al., 2018
myeloid cell lcp1 expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S6 with image from Sun et al., 2018
common myeloid progenitor myb expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image from Sun et al., 2018
lateral plate mesoderm gata1a expression decreased amount, abnormal AB + MO2-cftr standard conditions Fig. S10 with image,  Fig. S14 with image from Sun et al., 2018
neutrophil chemotaxis disrupted, abnormal i114Tg + MO1-cftr + MO2-cftr bacterial treatment: Pseudomonas aeruginosa PA14 Fig. 3 from Phennicie et al., 2010
neutrophil decreased amount, abnormal i114Tg + MO1-cftr + MO2-cftr bacterial treatment: Pseudomonas aeruginosa PA14 Fig. 3 from Phennicie et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.