Morpholino

MO1-arrb1

ID
ZDB-MRPHLNO-100311-1
Name
MO1-arrb1
Previous Names
None
Target
Sequence
5' - ACACCCTTGTGCCTTTATCTCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arrb1
Expressed Gene Anatomy Figures
bmp4 Fig. 2 with image from Yue et al., 2009
cdx4 Fig. 4 with image,  Fig. 6 with image from Yue et al., 2009
fli1 Fig. 2 with image from Yue et al., 2009
gata1a Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Yue et al., 2009
hbbe3 Fig. 3 with image from Yue et al., 2009
hey2 Fig. 4 with image from Zhang et al., 2015
hoxa9a Fig. 4 with image from Yue et al., 2009
hoxb4a Fig. 4 with image from Yue et al., 2009
hoxb7a Fig. 4 with image from Yue et al., 2009
lmo2 Fig. 2 with image,  Fig. 3 with image from Yue et al., 2009
myb Fig. 4 with image from Zhang et al., 2015
nkx2.5 Fig. 2 with image from Yue et al., 2009
ptch2 Fig. 2 with image from Yue et al., 2009
runx1 Fig. 4 with image from Zhang et al., 2015
spi1b Fig. 3 with image from Yue et al., 2009
tal1 Fig. 3 with image,  Fig. 4 with image,  Fig. 6 with image from Yue et al., 2009
Phenotype
Phenotype resulting from MO1-arrb1
Phenotype Fish Figures
brain decreased size, abnormal WT + MO1-arrb1 Fig. S2 from Li et al., 2016
caudal fin curled, abnormal WT + MO1-arrb1 Fig. S2 from Li et al., 2016
heart increased size, abnormal WT + MO1-arrb1 Fig. S2 from Li et al., 2016
microglial cell cell body increased size, abnormal zf147Tg + MO1-arrb1 Fig. 1 from Li et al., 2016
microglial cell cell body increased volume, abnormal zf147Tg + MO1-arrb1 Fig. 1,  Fig. 2 from Li et al., 2016
microglial cell cell projection increased amount, abnormal zf147Tg + MO1-arrb1 Fig. 1,  Fig. 2 from Li et al., 2016
microglial cell phagocytosis increased frequency, abnormal ion8dTg; s1984tTg; zf147Tg + MO1-arrb1 Fig. 3 from Li et al., 2016
nucleate erythrocyte decreased amount, abnormal WT + MO1-arrb1 Fig. 3 with image from Yue et al., 2009
optic tectum microglial cell morphology, abnormal zf147Tg + MO1-arrb1 Fig. 1,  Fig. 2 from Li et al., 2016
post-anal tail morphogenesis delayed, abnormal WT + MO1-arrb1 Fig. 1 with image from Yue et al., 2009
post-vent region curved ventral, abnormal WT + MO1-arrb1 Fig. 1 with image,  Fig. 3 with image,  Fig. 6 with image from Yue et al., 2009
ventral wall of dorsal aorta myb expression decreased amount, abnormal TU + MO1-arrb1 Fig. 4 with image from Zhang et al., 2015
ventral wall of dorsal aorta hey2 expression increased amount, abnormal TU + MO1-arrb1 Fig. 4 with image from Zhang et al., 2015
whole organism decreased length, abnormal WT + MO1-arrb1 Fig. S2 from Li et al., 2016
Fig. 1 with image,  Fig. 3 with image,  Fig. 6 with image from Yue et al., 2009
whole organism necrotic, abnormal WT + MO1-arrb1 Fig. 1 with image,  Fig. 6 with image from Yue et al., 2009
Phenotype of all Fish created by or utilizing MO1-arrb1
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta myb expression decreased amount, abnormal TU + MO1-arrb1 control Fig. 4 with image from Zhang et al., 2015
ventral wall of dorsal aorta hey2 expression increased amount, abnormal TU + MO1-arrb1 control Fig. 4 with image from Zhang et al., 2015
caudal fin curled, abnormal WT + MO1-arrb1 standard conditions Fig. S2 from Li et al., 2016
heart increased size, abnormal WT + MO1-arrb1 standard conditions Fig. S2 from Li et al., 2016
post-vent region curved ventral, abnormal WT + MO1-arrb1 standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 6 with image from Yue et al., 2009
brain decreased size, abnormal WT + MO1-arrb1 standard conditions Fig. S2 from Li et al., 2016
nucleate erythrocyte decreased amount, abnormal WT + MO1-arrb1 standard conditions Fig. 3 with image from Yue et al., 2009
whole organism necrotic, abnormal WT + MO1-arrb1 standard conditions Fig. 1 with image,  Fig. 6 with image from Yue et al., 2009
whole organism decreased length, abnormal WT + MO1-arrb1 standard conditions Fig. S2 from Li et al., 2016
Fig. 1 with image,  Fig. 3 with image,  Fig. 6 with image from Yue et al., 2009
post-anal tail morphogenesis delayed, abnormal WT + MO1-arrb1 standard conditions Fig. 1 with image from Yue et al., 2009
microglial cell cell projection increased amount, abnormal zf147Tg + MO1-arrb1 control Fig. 1,  Fig. 2 from Li et al., 2016
microglial cell cell body increased size, abnormal zf147Tg + MO1-arrb1 control Fig. 1 from Li et al., 2016
optic tectum microglial cell morphology, abnormal zf147Tg + MO1-arrb1 control Fig. 1,  Fig. 2 from Li et al., 2016
microglial cell cell body increased volume, abnormal zf147Tg + MO1-arrb1 control Fig. 1,  Fig. 2 from Li et al., 2016
microglial cell phagocytosis increased frequency, abnormal ion8dTg; s1984tTg; zf147Tg + MO1-arrb1 control Fig. 3 from Li et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.