Morpholino

MO2-gnptab

ID
ZDB-MRPHLNO-100302-2
Name
MO2-gnptab
Previous Names
None
Target
Sequence
5' - AAACATTTGTAGAGCCAACCTGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gnptab
Phenotype
Phenotype resulting from MO2-gnptab
Phenotype Fish Figures
branchiostegal ray disorganized, abnormal y1Tg + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
branchiostegal ray chondrocyte spheroid, abnormal y1Tg + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-gnptab Fig. 6 from Qian et al., 2015
ceratohyal cartilage malformed, abnormal WT + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
chondrocyte intercalation involved in growth plate cartilage morphogenesis disrupted, abnormal y1Tg + MO2-gnptab Fig. 5 from Flanagan-Steet et al., 2009
cranial cartilage chondrocyte hyperplastic, abnormal WT + MO2-gnptab Fig. 6 from Flanagan-Steet et al., 2009
cranial cartilage chondrocyte increased size, abnormal y1Tg + MO2-gnptab Fig. 5 from Flanagan-Steet et al., 2009
cranial cartilage collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab Fig. 4 from Flanagan-Steet et al., 2009
cysteine-type peptidase activity decreased process quality, abnormal WT + MO2-gnptab Fig. 4 with image from Qian et al., 2013
inner ear morphology, abnormal WT + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
mandibular arch skeleton decreased length, abnormal WT + MO2-gnptab Fig. 6 from Qian et al., 2015
mandibular arch skeleton flattened, abnormal WT + MO2-gnptab Fig. 6 from Qian et al., 2015
mandibular arch skeleton morphology, abnormal WT + MO2-gnptab Fig. 4 with image from Qian et al., 2013
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO2-gnptab Fig. 6 from Qian et al., 2015
Meckel's cartilage collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab Fig. 9 with image from Petrey et al., 2012
neurocranial trabecula collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab Fig. 9 with image from Petrey et al., 2012
neurocranium blunt, abnormal WT + MO2-gnptab Fig. 1 from Flanagan-Steet et al., 2009
otolith decreased size, abnormal WT + MO2-gnptab Fig. 7 from Flanagan-Steet et al., 2009
otolith mineralization disrupted, abnormal WT + MO2-gnptab Fig. 7 from Flanagan-Steet et al., 2009
palatoquadrate cartilage decreased length, abnormal WT + MO2-gnptab Fig. 2 from Flanagan-Steet et al., 2009
peptidyl-serine phosphorylation increased occurrence, abnormal WT + MO2-gnptab Fig. 8 from Flanagan-Steet et al., 2009
pericardium edematous, abnormal WT + MO2-gnptab Fig. 1Fig. 7 from Flanagan-Steet et al., 2009
ventral mandibular arch malformed, abnormal WT + MO2-gnptab Fig. 7 from Flanagan-Steet et al., 2009
ventral mandibular arch retracted, abnormal WT + MO2-gnptab Fig. 1 from Flanagan-Steet et al., 2009
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO2-gnptab Fig. 1 from Flanagan-Steet et al., 2009
yolk increased size, abnormal WT + MO2-gnptab Fig. 1 from Flanagan-Steet et al., 2009
Phenotype of all Fish created by or utilizing MO2-gnptab
Phenotype Fish Conditions Figures
mandibular arch skeleton morphology, abnormal WT + MO2-gnptab standard conditions Fig. 4 with image from Qian et al., 2013
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal WT + MO2-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
peptidyl-serine phosphorylation increased occurrence, abnormal WT + MO2-gnptab standard conditions Fig. 8 from Flanagan-Steet et al., 2009
otolith decreased size, abnormal WT + MO2-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Qian et al., 2015
cysteine-type peptidase activity decreased process quality, abnormal WT + MO2-gnptab standard conditions Fig. 4 with image from Qian et al., 2013
palatoquadrate cartilage decreased length, abnormal WT + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
otolith mineralization disrupted, abnormal WT + MO2-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
ventral mandibular arch malformed, abnormal WT + MO2-gnptab standard conditions Fig. 7 from Flanagan-Steet et al., 2009
mandibular arch skeleton decreased length, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Qian et al., 2015
yolk increased size, abnormal WT + MO2-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
ceratohyal cartilage malformed, abnormal WT + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
ventral mandibular arch retracted, abnormal WT + MO2-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
mandibular arch skeleton flattened, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Qian et al., 2015
neurocranium blunt, abnormal WT + MO2-gnptab standard conditions Fig. 1 from Flanagan-Steet et al., 2009
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Qian et al., 2015
inner ear morphology, abnormal WT + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
pericardium edematous, abnormal WT + MO2-gnptab standard conditions Fig. 1Fig. 7 from Flanagan-Steet et al., 2009
cranial cartilage chondrocyte hyperplastic, abnormal WT + MO2-gnptab standard conditions Fig. 6 from Flanagan-Steet et al., 2009
chondrocyte intercalation involved in growth plate cartilage morphogenesis disrupted, abnormal y1Tg + MO2-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2009
branchiostegal ray disorganized, abnormal y1Tg + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
cranial cartilage collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab standard conditions Fig. 4 from Flanagan-Steet et al., 2009
neurocranial trabecula collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab standard conditions Fig. 9 with image from Petrey et al., 2012
branchiostegal ray chondrocyte spheroid, abnormal y1Tg + MO2-gnptab standard conditions Fig. 2 from Flanagan-Steet et al., 2009
Meckel's cartilage collagen type II trimer increased amount, abnormal y1Tg + MO2-gnptab standard conditions Fig. 9 with image from Petrey et al., 2012
cranial cartilage chondrocyte increased size, abnormal y1Tg + MO2-gnptab standard conditions Fig. 5 from Flanagan-Steet et al., 2009
Citations