Morpholino

MO2-tyrp1b

ID
ZDB-MRPHLNO-091218-5
Name
MO2-tyrp1b
Previous Names
  • MO Dre_tyrp1b_ATG (1)
Target
Sequence
5' - GCACTAAACACACACTCTTCCACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tyrp1b
No data available
Phenotype
Phenotype resulting from MO2-tyrp1b
No data available
Phenotype of all Fish created by or utilizing MO2-tyrp1b
Phenotype Fish Conditions Figures
retinal pigmented epithelium zinc atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium melanocyte absent, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium selenium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
lens reflectivity, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 3 with image from Takamiya et al., 2016
retinal pigmented epithelium strontium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium potassium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
melanoblast cell maturation arrested, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
lens structure, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 3 with image from Takamiya et al., 2016
retinal pigmented epithelium bromine atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium calcium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium manganese atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium barium atom decreased amount, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium melanins brown, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium intracellular chemical homeostasis disrupted, abnormal WT + MO1-tyrp1a + MO2-tyrp1b standard conditions Fig. 2 with image from Takamiya et al., 2016
retinal pigmented epithelium brown, abnormal WT + MO2-tyrp1a + MO2-tyrp1b standard conditions Fig. S3 from Braasch et al., 2009
melanocyte brown, abnormal WT + MO2-tyrp1a + MO2-tyrp1b standard conditions Fig. S3 from Braasch et al., 2009
Citations