Research
General Information
ZIRC
ZFIN ID: ZDB-CDNA-040425-188
cDNA Name: MGC:56341
Species: Danio rerio
Library: Sugano SJD adult male
Digest:
Insert Size: 2069
Cloning Site: EcoRI-PstI
Vector Type: Plasmid
Vector: pME18S-FL3
Polymerase: T3 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Source:
Protocol: Thisse in situ hybridization protocol
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2004 [MGC:56341]
Curated Microarray Expression: GEO (1)
MARKER RELATIONSHIPS
MGC:56341 Is Encoded by: [Gene] cry3 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC046088 (1) 2069 bp
OTHER MGC:56341 cDNA PAGES No links to external sites
MAPPING INFORMATION Unknown
CITATIONS (4)