Morpholino Name: MO3-drl,drll.2
Targets: drl (1), drll.2 (1)
Sequence:
5' - TCAAGAACAGACACCAACCTCTTTG - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)