Morpholino Name: MO8-jag1b
Target: jag1b (1)
Sequence:
5' - ATCAAGACTCACCGTCGTCCGCAAG - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.