Morpholino Name: MO1-fdx1b
Target: fdx1b (1)
Sequence:
5' - GCACACACATACGATATGCCATGCT - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.