Morpholino Name: MO2-cyp19a1b
Target: cyp19a1b (1)
Sequence:
5' - CGAGCCTGAGAGGACAACAAAGACA - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)