Morpholino Name: MO1-cbx8a,arhgap17b
Targets: arhgap17b (1), cbx8a (1)
Sequence:
5' - ATCGTGTCATTACCACTCACTTTTG - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO. Targets both cbx8a and arhgap17b.