Morpholino Name: MO1-mir21-1
Target: mir21-1 (1)
Previous Names: dre-miR- 21-1 MO (1), multi-blocker (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTAACAGCCAACACCAGTCTGATAAGCTAT - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a multi-blocker morpholino that targets both Drosher and Dicer processing sites in pre-mir21-1.