Morpholino Name: MO1-opn4.1
Target: opn4.1 (1)
Sequence:
5' - CTCTCCATGAAGAGTGATGGCTCAT - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.