Morpholino Name: MO1-tardbp
Target: tardbp (1)
Previous Name: AMO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTACATCTCGGCCATCTTTCCTCAG - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is the corrected sequence for the tardbp MO published in Hum. Mol. Genet. 19(4): 671-683.