Morpholino Name: MO1-usp2a
Target: usp2a (1)
Sequence:
5' - TGTCACTGTATATGAATGTCGCATG - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)