Morpholino Name: MO1-mir138
Target: mir138 (1)
Previous Name: pri-miR-138 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GTGACATCGGCCTGATTCACAACACCAGCTG - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)