Morpholino Name: MO5-mpp5a
Target: mpp5a (1)
Sequence:
5' - CTCCAGCTCTGAAAGTACAAACACA - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino.