Morpholino Name: MO1-mir9
Targets: mir9-1 (1), mir9-2 (1), mir9-3 (1), mir9-4 (1), mir9-5 (1), mir9-6 (1), mir9-7 (1)
Previous Names: dre-mir-9 MO (1), MO1-mirn9 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TCATACAGCTAGATAACCAAAGA - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)