Morpholino Name: MO3-etv2
Target: etsrp (1)
Previous Name: MO3-ets1b

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGTTTTGACAGTGCCTCAGCTCTGC - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: targets -10 to -34 of the 5' UTR