CRISPR Name: CRISPR2-nrp1b
Target: nrp1b (1)
Source:
Target Sequence:
5' - GAATTTTGACCTGGAAAGCC - 3'
  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The first "GA" was added to improve binding.