Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
10	56.4 cM	z7504	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
20	6.9 cR	Z7504	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
10	1849.0 cR	z7504	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
m347	Feature	10		Bendig et al., 2006	Bendig, et al. (2006. Genes Dev. 20:2361-2372) reports mapping m347 to LG10 between z7504 and z7028.
z7028	SSLP	10		Bendig et al., 2006	Bendig, et al. (2006. Genes Dev. 20:2361-2372) reports mapping m347 to LG10 between z7504 and z7028.
a14	Feature	10	0.2 cM	Brockerhoff, 2001
ta90	Feature	10		Carney et al., 2010
frem2a	GENE	10		Carney et al., 2010
z25833	SSLP	10		Thomas et al., 2011	Thomas et al. (2011 Invest. Ophthalmol. Vis. Sci.52, 3119-3128) mapped vps11wsu1 (platinum) to Chr 10 by bulk segregant analysis.
dlg2	GENE	10		Thomas et al., 2011	Thomas et al. (2011 Invest. Ophthalmol. Vis. Sci.52, 3119-3128) mapped vps11wsu1 (platinum) to Chr 10 by bulk segregant analysis.
wsu1	Feature	10		Thomas et al., 2011	Thomas et al. (2011 Invest. Ophthalmol. Vis. Sci.52, 3119-3128) mapped vps11wsu1 (platinum) to Chr 10 by bulk segregant analysis.
vps11	GENE	10		Thomas et al., 2011	Thomas et al. (2011 Invest. Ophthalmol. Vis. Sci.52, 3119-3128) mapped vps11wsu1 (platinum) to Chr 10 by bulk segregant analysis.
z9574	SSLP	10		Thomas et al., 2011	Thomas et al. (2011 Invest. Ophthalmol. Vis. Sci.52, 3119-3128) mapped vps11wsu1 (platinum) to Chr 10 by bulk segregant analysis.
fb79h03	EST	10	0.24 cM	Van Epps et al., 2004	Van Epps et al. (2004) used recombination analysis to localize the a14 allele  ... Van Epps et al. (2004) used recombination analysis to localize the a14 allele of the nrc locus (no optokinetic response c) to LG 10 in a 0.24 cM region between EST fb79h03 and Z-marker Z7504. A subsequent chromosome walk using a BAC library from Incyte Genomics showed that the nrc locus is at most 0.04 cM from EST fb02f11. This EST was shown to be encoded by the zebrafish synj1 gene, which was then identified with the nrc locus.
a14	Feature	10		Van Epps et al., 2004	Van Epps et al. (2004) used recombination analysis to localize the a14 allele  ... Van Epps et al. (2004) used recombination analysis to localize the a14 allele of the nrc locus (no optokinetic response c) to LG 10 in a 0.24 cM region between EST fb79h03 and Z-marker Z7504. A subsequent chromosome walk using a BAC library from Incyte Genomics showed that the nrc locus is at most 0.04 cM from EST fb02f11. This EST was shown to be encoded by the zebrafish synj1 gene, which was then identified with the nrc locus.
fb02f11	EST	10		Van Epps et al., 2004	Van Epps et al. (2004) used recombination analysis to localize the a14 allele  ... Van Epps et al. (2004) used recombination analysis to localize the a14 allele of the nrc locus (no optokinetic response c) to LG 10 in a 0.24 cM region between EST fb79h03 and Z-marker Z7504. A subsequent chromosome walk using a BAC library from Incyte Genomics showed that the nrc locus is at most 0.04 cM from EST fb02f11. This EST was shown to be encoded by the zebrafish synj1 gene, which was then identified with the nrc locus.

OTHER MAPPING INFORMATION

Chr 10 Bendig et al., 2006 Bendig, et al. (2006. Genes Dev. 20:2361-2372) reports mapping m347 to LG10 between z7504  ... Bendig, et al. (2006. Genes Dev. 20:2361-2372) reports mapping m347 to LG10 between z7504 and z7028.   Chr 10 Carney et al., 2010   Chr 10 Thomas et al., 2011 Thomas et al. (2011 Invest. Ophthalmol. Vis. Sci.52, 3119-3128) mapped vps11wsu1  ... Thomas et al. (2011 Invest. Ophthalmol. Vis. Sci.52, 3119-3128) mapped vps11wsu1 (platinum) to Chr 10 by bulk segregant analysis.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	0,172		60.0
Forward Primer	AATTGGGCTGCGTTTCATAC
Reverse Primer	TTCCACCTCCTGTAACCTGC
AB	0,178		60.0
Forward Primer	AATTGGGCTGCGTTTCATAC
Reverse Primer	TTCCACCTCCTGTAACCTGC
TU	0,176		60.0
Forward Primer	AATTGGGCTGCGTTTCATAC
Reverse Primer	TTCCACCTCCTGTAACCTGC
EKW	182,174,164		60.0
Forward Primer	AATTGGGCTGCGTTTCATAC
Reverse Primer	TTCCACCTCCTGTAACCTGC