Mapping Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
19	31.9 cM	z7450	Boston MGH Cross (MGH)	Fishman, Mark C.	Data
19	611.0 cR	z7450	Goodfellow T51 (T51)	Geisler, Robert	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
z40343	SSLP	19		Huang et al., 2009	Huang et al.(2009, Dev. Biol. 332(2): 360-3700 mapped prp to Chr 19 using a variety of methods.
z3782	SSLP	19		Huang et al., 2009	Huang et al.(2009, Dev. Biol. 332(2): 360-3700 mapped prp to Chr 19 using a variety of methods.
z4825	SSLP	19		Huang et al., 2009	Huang et al.(2009, Dev. Biol. 332(2): 360-3700 mapped prp to Chr 19 using a variety of methods.
illr2	GENE	19		Panagos et al., 2006	Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19  ... Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19 using the T51 radiation hybrid panel between the z21694 and z7450 markers. Using sequence analyses, they were able to identify the illr1, illr2 and illr3 genes on the BAC CH211-133N4. The order of genes on this BAC was determined to be: illr2 - illr3 - illr1.
illr4	GENE	19		Panagos et al., 2006	Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19  ... Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19 using the T51 radiation hybrid panel between the z21694 and z7450 markers. Using sequence analyses, they were able to identify the illr1, illr2 and illr3 genes on the BAC CH211-133N4. The order of genes on this BAC was determined to be: illr2 - illr3 - illr1.
illr3	GENE	19		Panagos et al., 2006	Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19  ... Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19 using the T51 radiation hybrid panel between the z21694 and z7450 markers. Using sequence analyses, they were able to identify the illr1, illr2 and illr3 genes on the BAC CH211-133N4. The order of genes on this BAC was determined to be: illr2 - illr3 - illr1.
z21694	SSLP	19		Panagos et al., 2006	Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19  ... Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19 using the T51 radiation hybrid panel between the z21694 and z7450 markers. Using sequence analyses, they were able to identify the illr1, illr2 and illr3 genes on the BAC CH211-133N4. The order of genes on this BAC was determined to be: illr2 - illr3 - illr1.
z3782	SSLP	19		Rajarao et al., 2001	Rajarao, et al. (2001. Genome Res 11:1211-1220.) report mapping atp1a3a to  ... Rajarao, et al. (2001. Genome Res 11:1211-1220.) report mapping atp1a3a to LG19 between z7450 and z3782 on one or more of the T51, LN54, or Heat Shock mapping panels.
atp1a3a	GENE	19		Rajarao et al., 2001	Rajarao, et al. (2001. Genome Res 11:1211-1220.) report mapping atp1a3a to  ... Rajarao, et al. (2001. Genome Res 11:1211-1220.) report mapping atp1a3a to LG19 between z7450 and z3782 on one or more of the T51, LN54, or Heat Shock mapping panels.

OTHER MAPPING INFORMATION

Chr 19 Rajarao et al., 2001 Rajarao, et al. (2001. Genome Res 11:1211-1220.) report mapping atp1a3a to LG19 between z7450 and  ... Rajarao, et al. (2001. Genome Res 11:1211-1220.) report mapping atp1a3a to LG19 between z7450 and z3782 on one or more of the T51, LN54, or Heat Shock mapping panels.   Chr 19 Panagos et al., 2006 Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19 using the T51 radiation  ... Panagos PG et al (Immunogenetics 58: 31-40) mapped the illr1 gene to LG 19 using the T51 radiation hybrid panel between the z21694 and z7450 markers. Using sequence analyses, they were able to identify the illr1, illr2 and illr3 genes on the BAC CH211-133N4. The order of genes on this BAC was determined to be: illr2 - illr3 - illr1.   Chr 19 Huang et al., 2009 Huang et al.(2009, Dev. Biol. 332(2): 360-3700 mapped prp to Chr 19 using a variety of  ... Huang et al.(2009, Dev. Biol. 332(2): 360-3700 mapped prp to Chr 19 using a variety of methods.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
IND	0,185		60.0
Forward Primer	TCTCACTCATCCAGATCATCTATCA
Reverse Primer	TCACTGGTAAACACTGTCAGCA
AB	227,0,229		60.0
Forward Primer	TCTCACTCATCCAGATCATCTATCA
Reverse Primer	TCACTGGTAAACACTGTCAGCA
EKW	0,185		60.0
Forward Primer	TCTCACTCATCCAGATCATCTATCA
Reverse Primer	TCACTGGTAAACACTGTCAGCA
TU	0,185		60.0
Forward Primer	TCTCACTCATCCAGATCATCTATCA
Reverse Primer	TCACTGGTAAACACTGTCAGCA