ZFIN ID: ZDB-SSLP-980528-1482

Mapping Details

SSLP: z11119
PHYSICAL MAP AND BROWSER No data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 40.2 cM z11119 Boston MGH Cross (MGH) Fishman, Mark C. Data
7 122.6 cR Z11119 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
7 2858.0 cR z11119 Goodfellow T51 (T51) Geisler, Robert Data
7 68.4 cM z11119 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z8693 SSLP 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an  ...
fb50h01 EST 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ...
i26 Feature 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ...
z8693 SSLP 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ...
aldh1a2 GENE 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an  ...
z20853 SSLP 7 Farber et al., 2003 Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7  ...
anxa2b GENE 7 Farber et al., 2003 Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7  ...
scube2 GENE 7 Hollway et al., 2006 Marker z11119 was found to be non-recombinant in 1400 meioses.
scube2 GENE 7 Kawakami et al., 2005  ...
adgrg1 GENE 7 Kawakami et al., 2005  ...
slc7a6os GENE 7 Kawakami et al., 2005  ...
z24045 SSLP 7 Kawakami et al., 2005  ...
slc7a6 GENE 7 Kawakami et al., 2005  ...
dennd2b GENE 7 Kawakami et al., 2005  ...
anxa2b GENE 7 Smart et al., 2004 Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b  ...
z20853 SSLP 7 Smart et al., 2004 Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b  ...
fk03a Feature 7 Sullivan-Brown et al., 2008 Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to  ...
z15270 SSLP 7 Sullivan-Brown et al., 2008 Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to  ...
ty97 Feature 7 Woods et al., 2005
z15270 SSLP 7 Woods et al., 2005

OTHER MAPPING INFORMATION
Chr 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to demonstrate the nls  ...
Chr 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an EST (fb50h01) mapped  ...
Chr 7 Farber et al., 2003 Farber et al. (Genome Res 13, 1082-1096, 2003) mapped the anxa2b gene to LG7 between Z20853 and  ...
Chr 7 Smart et al., 2004 Smart EJ et al (Proc. Natl. Acad. Sci USA 101, 3450-3455) mapped the anx2b gene to LG7 between  ...
Chr 7 Kawakami et al., 2005 Kawakami+A+et+al+mapped+the+you+mutation+between+z11119+and+z24045+on+LG+7%2e+This+critical+region+w  ...
Chr 7 Woods et al., 2005
Chr 7 Hollway et al., 2006 Marker z11119 was found to be non-recombinant in 1400 meioses.
Chr 7 Sullivan-Brown et al., 2008 Sullivan-Brown, et al. (2008. Dev. Biol. 314:261-275) reports mapping swt to LG7 between Z11119 and  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 0,139 60.0
Forward Primer GAAAGGGCTCGATATTGCTC
Reverse Primer AAAGGACCTTCGCTTTGTGA
IND 133,0,151 60.0
Forward Primer GAAAGGGCTCGATATTGCTC
Reverse Primer AAAGGACCTTCGCTTTGTGA
TU 139,0,179 60.0
Forward Primer GAAAGGGCTCGATATTGCTC
Reverse Primer AAAGGACCTTCGCTTTGTGA
EKW 0,149 60.0
Forward Primer GAAAGGGCTCGATATTGCTC
Reverse Primer AAAGGACCTTCGCTTTGTGA