ZFIN ID: ZDB-SSLP-980528-1069

Mapping Details

SSLP: z8693
PHYSICAL MAP AND BROWSER No data available
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 41.5 cM z8693 Boston MGH Cross (MGH) Fishman, Mark C. Data
7 2974.0 cR z8693 Goodfellow T51 (T51) Geisler, Robert Data
7 76.5 cM z8693 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
z10441 SSLP 7 Alexa et al., 2009 Alexa et al. (2009.PLoS One 4(12):e8261) report mapping um22 to LG7, linked to  ...
um22 Feature 7 Alexa et al., 2009 Alexa et al. (2009.PLoS One 4(12):e8261) report mapping um22 to LG7, linked to  ...
aldh1a2 GENE 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an  ...
i26 Feature 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ...
z11119 SSLP 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ...
fb50h01 EST 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to  ...
z11119 SSLP 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an  ...
z1182 SSLP 7 Wingert et al., 2011 Wingert and Davidson report mapping n15 to Chr. 7 using meiotic mapping.
z11894 SSLP 7 Wingert et al., 2011 Wingert and Davidson report mapping n15 to Chr. 7 using meiotic mapping.
z4999 SSLP 7 Wingert et al., 2011 Wingert and Davidson report mapping n15 to Chr. 7 using meiotic mapping.
hu255H Feature 7 van Rooijen et al., 2008 van Rooijen et al. (2008. J. Am. Soc. Nephrol. 19:1128-1138) reports mapping  ...
z15270 SSLP 7 van Rooijen et al., 2008 van Rooijen et al. (2008. J. Am. Soc. Nephrol. 19:1128-1138) reports mapping  ...
nz15 Feature 7 0.14 cM Wingert et al., 2011 Wingert and Davidson report mapping n15 to Chr. 7 using meiotic mapping.

OTHER MAPPING INFORMATION
Chr 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) used bulk segregant analysis to demonstrate the nls  ...
Chr 7 Begemann et al., 2001 Begemann, et al. (2001. Dev 128:3081-3094.) report aldh1a2 corresponds to an EST (fb50h01) mapped  ...
Chr 7 van Rooijen et al., 2008 van Rooijen et al. (2008. J. Am. Soc. Nephrol. 19:1128-1138) reports mapping hu255H to LG7, between  ...
Chr 7 Alexa et al., 2009 Alexa et al. (2009.PLoS One 4(12):e8261) report mapping um22 to LG7, linked to Z10441 and Z8693.
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
AB 0,222 60.0
Forward Primer GCTTTTTGAGCAGATGAGGC
Reverse Primer CATGTACGCGTTGACTTTGC
IND 0,176 60.0
Forward Primer GCTTTTTGAGCAGATGAGGC
Reverse Primer CATGTACGCGTTGACTTTGC
TU 220,194,176 60.0
Forward Primer GCTTTTTGAGCAGATGAGGC
Reverse Primer CATGTACGCGTTGACTTTGC
EKW 0,222 60.0
Forward Primer GCTTTTTGAGCAGATGAGGC
Reverse Primer CATGTACGCGTTGACTTTGC