ZFIN ID: ZDB-GENE-980526-70

Mapping Details

Gene Name: homeobox B5a
Symbol: hoxb5a
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 3 23,707,691 - 23,710,095
Ensembl 3 23,707,691 - 23,710,095
Vega 3 23,577,143 - 23,579,547
NCBI Map Viewer 3 23,707,700 - 23,710,095
UCSC 3 -
Mapped Clones containing hoxb5a
CH211-72A16 Chr: 3 Details
BUSM1-254O17 Chr: 3 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
3 46.0cM hoxb5a Mother of Pearl (MOP) Postlethwait, John H. Data
3 181.91cR ZF21 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
hoxb1a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb2a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb3a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb4a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb6a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb8a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb9a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb7a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb10a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
eve1 GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb4a GENE 3 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped  ...
mir10c MIRNAG 3 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped  ...

OTHER MAPPING INFORMATION
Chr 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1,  ...
Chr 3 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10c between  ...
Markers Encoded by hoxb5a
fc38c09Chr: 3 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1736 DraI 36.0
Forward Primer ACACGTACACGTTTCAGTCACA
Reverse Primer ACAGGTCAGCTTTCTCTTTTGG