header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-69

Mapping Details

Gene Name: even-skipped-like1
Symbol: eve1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 3 23,641,935 - 23,643,830
Ensembl 3 23,641,935 - 23,643,830
Vega 3 23,511,387 - 23,513,282
NCBI Map Viewer 3 23,641,926 - 23,644,276
UCSC 3 -
Mapped Clones containing eve1
CH211-72A16 Chr: 3 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
3 46.0cM eve1 Mother of Pearl (MOP) Postlethwait, John H. Data
3 162.38cR eve1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
3 44.1cM eve1 Heat Shock (HS) Woods, Ian G. Data
3 54.66cM eve1 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
hoxb10a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb7a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb9a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb8a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb6a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb4a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb3a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb2a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb1a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...
hoxb5a GENE 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.)  ...

OTHER MAPPING INFORMATION
Chr 3 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report eve1,  ...
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 580 Sau96I 36.0
Forward Primer CTACTGAATGGTATCGACCAAA
Reverse Primer ACGTTGTCTCTTGTCCTTCATT