Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 23 36,118,738 - 36,120,511 GRCz11 Ensembl 23 36,118,738 - 36,120,511 GRCz11 Vega 23 36,019,935 - 36,021,708 GRCv10 NCBI Map Viewer 23 36,118,399 - 36,120,511 GRCz11 UCSC 23 - GRCv10

Mapped Clones containing hoxc5a
DKEY-81P22	Chr: 23 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
23	125.1 cM	hoxc5a	Mother of Pearl (MOP)	Postlethwait, John H.	Data
23	433.6 cR	hoxc5	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
23	5381.0 cR	hoxc5a	Goodfellow T51 (T51)	Geisler, Robert	Data
23	105.1 cM	hoxc5a	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
hoxc10a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc11a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc4a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc6a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc8a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc1a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc9a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc3a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
hoxc13a	GENE	23		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.
z3157	SSLP	23		Pratt et al., 2002	Pratt et al. (2002. Physiol Genomics 11: 91-98) report mapping nfe2 to Linkage Group 23, using both a genetic backcross panel as well as a radiation hybrid panel. They placed nfe2 2.17 +/- 2.15 cM from hoxc5a and 15.22 +/- 5.30 from SSLP z3157.
nfe2	GENE	23	2.17 cM	Pratt et al., 2002	Pratt et al. (2002. Physiol Genomics 11: 91-98) report mapping nfe2 to Linkage Group 23, using both a genetic backcross panel as well as a radiation hybrid panel. They placed nfe2 2.17 +/- 2.15 cM from hoxc5a and 15.22 +/- 5.30 from SSLP z3157.
hoxc4a	GENE	23		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxc4a and hoxc5a.
dre-mir-10b-2	MIRNAG	23		Woltering et al., 2006	Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxc4a and hoxc5a.

OTHER MAPPING INFORMATION

Chr 23 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a,  ... Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxc13a, hoxc11a, hoxc10a, hoxc9a, hoxc8a, hoxc6a, hoxc5a, hoxc4a, hoxc3a, and hoxc1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG23.   Chr 23 Woltering et al., 2006 Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between  ... Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10b-1 between hoxc4a and hoxc5a.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	439	HhaI	36.0
Forward Primer	CATTGTCAGTTTGGTTCATCTT
Reverse Primer	GAACTCTTTCTCCAACTCCAG