header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-44

Mapping Details

Gene Name: patched 2
Symbol: ptch2
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 2 33,969,667 - 33,993,533
Ensembl 2 33,969,667 - 33,993,533
Vega 2 33,986,449 - 34,010,315
NCBI Map Viewer 2 33,969,212 - 33,993,636
UCSC 2 -
Mapped Clones containing ptch2
CH211-226H23 Chr: 2 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
au1 2 33,983,412 GRCz11 Lee et al., 2012
sa19807 2 33,983,706 GRCz11 Busch-Nentwich et al., 2013
2 34,000,488 GRCz10 Busch-Nentwich et al., 2013
2 33,701,581 Zv9 Busch-Nentwich et al., 2013
sa38340 2 33,978,752 GRCz11 Busch-Nentwich et al., 2013
2 33,995,534 GRCz10 Busch-Nentwich et al., 2013
2 33,696,627 Zv9 Busch-Nentwich et al., 2013
sa39869 2 33,969,523 GRCz11 Busch-Nentwich et al., 2013
2 33,986,305 GRCz10 Busch-Nentwich et al., 2013
2 33,687,398 Zv9 Busch-Nentwich et al., 2013
sa44536 2 33,975,270 GRCz11 Busch-Nentwich et al., 2013
2 33,992,052 GRCz10 Busch-Nentwich et al., 2013
2 33,693,145 Zv9 Busch-Nentwich et al., 2013
la010757Tg 2 33,702,299 - 33,702,309 Zv9
la014919Tg 2 33,706,998 - 33,707,008 Zv9
la028797Tg 2 33,710,614 - 33,710,624 Zv9

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
2 129.9 cM ptc1 Mother of Pearl (MOP) Postlethwait, John H. Data
2 433.54 cR ptc1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
2 2851.0 cR ptc1 Goodfellow T51 (T51) Geisler, Robert Data
2 89.7 cM ptc1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
atp6v0b GENE 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...
z7632 SSLP 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...
z13521 SSLP 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...
z11410 SSLP 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...
z8451 SSLP 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that  ...

OTHER MAPPING INFORMATION
Chr 2 Lee et al., 2008 Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that places the blowout  ...
Genomic Feature tc294z is an allele of ptch2
Chr Location Mapped As Panel Mapped By Scoring
2 50.5 cM tc294z Boston MGH Cross (MGH) Geisler, Robert Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 480 36.0
Forward Primer AGCAAGGAGCTACGCTACAC
Reverse Primer GCAGGGGAAAAGCTTATCAA