ZFIN ID: ZDB-GENE-980526-436

Mapping Details

Gene Name: retinoid x receptor, beta a
Symbol: rxrba
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 19 7,249,041 - 7,274,844 GRCz11
Ensembl 19 7,249,041 - 7,274,844 GRCz11
Vega 19 7,330,116 - 7,355,919 GRCv10
NCBI Map Viewer 19 7,244,838 - 7,273,052 GRCz11
UCSC 19 - GRCv10
Mapped Clones containing rxrba
BUSM1-12F11 Chr: 19 Details
DKEYP-84F11 Chr: 19 Details
CH73-216M24 Chr: 19 Details
CH1073-247J7 Chr: 19 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa43215 19 7,250,339 GRCz11 Busch-Nentwich et al., 2013
19 7,331,414 GRCz10 Busch-Nentwich et al., 2013
19 7,872,875 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
19 50.7 cM rxre Mother of Pearl (MOP) Postlethwait, John H. Data
19 132.13 cR rxre Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
19 919.0 cR rxre Goodfellow T51 (T51) Geisler, Robert Data
19 37.6 cM rxre Heat Shock (HS) Woods, Ian G. Data
19 12.72 cM rxre Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by rxrba
fb93c09 Ambiguous Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 722 DpnII 36.0
Forward Primer GACACCCCAATCGACACCTT
Reverse Primer AGATGCAGCAGGCCAAGAAT