ZFIN ID: ZDB-GENE-980526-287

Mapping Details

Gene Name: hemoglobin beta embryonic-3
Symbol: hbbe3
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 12 20,339,413 - 20,340,543 GRCz11
Ensembl 12 20,339,413 - 20,340,543 GRCz11
Vega 12 20,217,539 - 20,218,669 GRCv10
NCBI Map Viewer 12 20,339,469 - 20,340,543 GRCz11
UCSC 12 - GRCv10
Mapped Clones containing hbbe3
CH211-218L14 Chr: 12 Details
PHYSICAL MAPPING No data available

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
12 78.9 cM hbbe3 Mother of Pearl (MOP) Postlethwait, John H. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 180 36.0
Forward Primer GCTTAACTAGGTTTATGTTA
Reverse Primer AGTCTTATTTCTTCTAAATT