ZFIN ID: ZDB-GENE-980526-249

Mapping Details

Gene Name: wingless-type MMTV integration site family, member 11
Symbol: wnt11
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 10 32,104,305 - 32,123,204 GRCz11
Ensembl 10 32,104,305 - 32,123,204 GRCz11
Vega 10 32,160,445 - 32,179,344 GRCv10
NCBI Map Viewer 10 32,104,343 - 32,123,204 GRCz11
UCSC 10 - GRCv10
Mapped Clones containing wnt11
DKEY-250D21 Chr: 10 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa2545 10 32,116,982 GRCz11 Busch-Nentwich et al., 2013
10 32,173,122 GRCz10 Busch-Nentwich et al., 2013
10 33,071,773 Zv9 Busch-Nentwich et al., 2013
sa27632 10 32,117,049 GRCz11 Busch-Nentwich et al., 2013
10 32,173,189 GRCz10 Busch-Nentwich et al., 2013
10 33,071,840 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
10 91.3 cM wnt11r Mother of Pearl (MOP) Postlethwait, John H. Data
10 52.4 cM wnt11r Heat Shock (HS) Woods, Ian G. Data
10 46.86 cM wnt11r Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Markers Encoded by wnt11
fk73h04 Chr: 10 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 732 36.0
Forward Primer CCGAGGCTACAACCCTTACA
Reverse Primer CAGAGAGGTTTTGCCGTTTCT