Mapping Details

Genome Browser Chr Position Assembly ZFIN JBrowse 9 2,002,701 - 2,007,106 GRCz11 Ensembl 9 2,002,701 - 2,007,106 GRCz11 Vega 9 2,001,904 - 2,006,309 GRCv10 NCBI Map Viewer 9 2,002,701 - 2,007,106 GRCz11 UCSC 9 - GRCv10

Mapped Clones containing evx2
RP71-78H1	Chr: 9 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
9	15.7 cM	evx2	Mother of Pearl (MOP)	Postlethwait, John H.	Data
9	208.38 cR	Evx-2	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
9	0.0 cM	evx2	Heat Shock (HS)	Woods, Ian G.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
hoxd10a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd11a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd12a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd13a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd3a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd9a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.
hoxd4a	GENE	9		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.

OTHER MAPPING INFORMATION

Chr 9 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2,  ... Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx2, hoxd13a, hoxd12a, hoxd11a, hoxd10a, hoxd9a, hoxd4a, and hoxd3a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG09.

Primer Sets:

Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	850		36.0
Forward Primer	AACGACAACACCTCCTCAAC
Reverse Primer	CAGTCTTCCGATCTGCTCTC