header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-176

Mapping Details

Gene Name: cyclin D1
Symbol: ccnd1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 7 54,671,749 - 54,679,595
Ensembl 7 54,671,749 - 54,679,595
Vega 7 54,402,097 - 54,409,943
NCBI Map Viewer 7 54,670,054 - 54,677,422
UCSC 7 -
Mapped Clones containing ccnd1
CH211-188I17 Chr: 7 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa14707 7 54,675,331 GRCz11 Busch-Nentwich et al., 2013
7 54,405,679 GRCz10 Busch-Nentwich et al., 2013
7 54,579,403 Zv9 Busch-Nentwich et al., 2013
sa21083 7 54,677,030 GRCz11 Busch-Nentwich et al., 2013
7 54,407,378 GRCz10 Busch-Nentwich et al., 2013
7 54,577,704 Zv9 Busch-Nentwich et al., 2013
sa34190 7 54,675,549 GRCz11 Busch-Nentwich et al., 2013
7 54,405,897 GRCz10 Busch-Nentwich et al., 2013
7 54,579,185 Zv9 Busch-Nentwich et al., 2013
la016165Tg 7 54,575,397 - 54,575,407 Zv9
la016166Tg 7 54,575,856 - 54,575,866 Zv9
la026147Tg 7 54,575,688 - 54,575,698 Zv9

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 147.6cM cycd1 Mother of Pearl (MOP) Postlethwait, John H. Data
7 264.13cR cycD1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
7 5890.0cR cycd1 Goodfellow T51 (T51) Geisler, Robert Data
7 127.9cM cnnd1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.
MAPPING FROM PUBLICATIONS
Marker Type Chr Distance Publication / Person Comments
fgf4 GENE unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ...
fgf19 GENE unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ...
lto1 GENE unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1,  ...

OTHER MAPPING INFORMATION
Chr unknown Katoh et al., 2003 Katoh and Katoh (Int J Mol Med 12: 45-50, 2003) found that the ccnd1, oraov1, fgf19 and fgf4 genes  ...
Markers Encoded by ccnd1
fb52e01Chr: 7 Details
fc45c08Chr: 7 Details
fc83a12Chr: 7 Details
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 979 AciI 36.0
Forward Primer ACGTGGACCTCTCTTGCACT
Reverse Primer TCAGCCTTAAACGACGGACT