ZFIN ID: ZDB-GENE-980526-171

Mapping Details

Gene Name: T-box transcription factor 16, like
Symbol: tbx16l
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position Assembly
ZFIN Gbrowse 5 42,280,372 - 42,297,333 GRCz11
Ensembl 5 42,280,372 - 42,297,333 GRCz11
Vega 5 41,680,219 - 41,697,180 GRCv10
NCBI Map Viewer 5 42,280,120 - 42,302,298 GRCz11
UCSC 5 - GRCv10
Mapped Clones containing tbx16l
CH211-207C6 Chr: 5 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa31470 5 42,282,415 GRCz11 Busch-Nentwich et al., 2013
5 41,682,262 GRCz10 Busch-Nentwich et al., 2013
5 43,900,997 Zv9 Busch-Nentwich et al., 2013
z34 5 42,282,323 - 42,282,330 GRCz11 Morrow et al., 2017
z35 5 42,282,325 - 42,282,331 GRCz11 Morrow et al., 2017

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
7 113.0 cM tbx6 Mother of Pearl (MOP) Postlethwait, John H. Data
5 212.2 cR tbx6 Loeb/NIH/5000/4000 (LN54) Johnson, Stephen L. Data
5 2958.0 cR tbx6 Goodfellow T51 (T51) Geisler, Robert Data
5 86.5 cM tbx6 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 318 36.0
Forward Primer AGGGTGAAGTGTTTTGGGGCATAA
Reverse Primer GCGCTCTGGCACACCTCTTCTAAC