header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-GENE-980526-144

Mapping Details

Gene Name: hairy-related 6
Symbol: her6
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 6 36,551,083 - 36,552,844
Ensembl 6 36,551,083 - 36,552,844
Vega 6 36,573,189 - 36,574,950
NCBI Map Viewer 6 36,551,083 - 36,552,768
UCSC 6 -
Mapped Clones containing her6
DKEY-111K7 Chr: 6 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa20748 6 36,552,252 GRCz11 Busch-Nentwich et al., 2013
6 36,574,358 GRCz10 Busch-Nentwich et al., 2013
6 36,330,824 Zv9 Busch-Nentwich et al., 2013
sa38559 6 36,552,435 GRCz11 Busch-Nentwich et al., 2013
6 36,574,541 GRCz10 Busch-Nentwich et al., 2013
6 36,331,007 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
6 134.1cM her6 Mother of Pearl (MOP) Postlethwait, John H. Data
6 352.38cR HER-6 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
6 74.43cM her6 Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 419 36.0
Forward Primer GCAACCGACGGACAGTTCGC
Reverse Primer AACGTGGAAAGATACCGCAAATA