ZFIN ID: ZDB-GENE-980526-135

Mapping Details

Gene Name: Indian hedgehog signaling molecule b
Symbol: ihhb
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 6 7,059,999 - 7,082,108
Ensembl 6 7,059,999 - 7,082,108
Vega 6 6,902,830 - 6,924,939
NCBI Map Viewer 6 7,059,999 - 7,082,672
UCSC 6 -
Mapped Clones containing ihhb
CH211-237C6 Chr: 6 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa20623 6 7,060,492 GRCz11 Busch-Nentwich et al., 2013
6 6,903,323 GRCz10 Busch-Nentwich et al., 2013
6 6,977,307 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
6 36.6cM ehh Mother of Pearl (MOP) Postlethwait, John H. Data
6 558.0cR ehh Goodfellow T51 (T51) Geisler, Robert Data
6 25.5cM ehh Heat Shock (HS) Woods, Ian G. Data
6 27.94cM ehh Gates et al (GAT) Talbot, William S. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 378 MseI 36.0
Forward Primer CGATGCTCAAGTGGGTCAGT
Reverse Primer CTCCACCAATCCCTGCGT