ZFIN ID: ZDB-GENE-980526-526

Mapping Details

Gene Name: wingless-type MMTV integration site family, member 1
Symbol: wnt1
PHYSICAL MAP AND BROWSER
Genome Browser Chr Position
ZFIN Gbrowse 23 27,652,906 - 27,658,054
Ensembl 23 27,652,906 - 27,658,054
Vega 23 27,726,365 - 27,731,513
NCBI Map Viewer 23 27,651,609 - 27,658,376
UCSC 23 -
Mapped Clones containing wnt1
DKEY-166N8 Chr: 23 Details
PHYSICAL MAPPING
Feature Chr Position Assembly Citations
sa24353 23 27,654,925 GRCz11 Busch-Nentwich et al., 2013
23 27,728,384 GRCz10 Busch-Nentwich et al., 2013
23 27,895,562 Zv9 Busch-Nentwich et al., 2013

GENETIC MAPPING PANELS
Chr Location Mapped As Panel Mapped By Scoring
23 111.3cM wnt1 Mother of Pearl (MOP) Postlethwait, John H. Data
23 282.89cR wnt1 Loeb/NIH/5000/4000 (LN54) Dawid, Igor B. Data
23 4234.0cR wnt1 Goodfellow T51 (T51) Geisler, Robert Data
23 89.4cM wnt1 Heat Shock (HS) Woods, Ian G. Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location.
Physical map location should be used whenever possible.

OTHER MAPPING INFORMATION
Primer Sets:
Strain Bandsize Restriction Enzyme Annealing Temperature [C]
SJD 1700,2200 36.0
Forward Primer TGACCAACCTGCACAACAAT
Reverse Primer ATCCCGAGATGAAGGGAGTT
Genomic Feature sa24353 is an allele of wnt1