ZFIN ID: ZDB-GENE-980526-44

Mapping Details

Gene Name:	patched 2
Symbol:	ptch2

PHYSICAL MAP AND BROWSER

Genome Browser	Chr	Position	Assembly
ZFIN JBrowse	2	33,969,667 - 33,993,533	GRCz11
Ensembl	2	33,969,667 - 33,993,533	GRCz11
Vega	2	33,986,449 - 34,010,315	GRCv10
NCBI Map Viewer	2	33,969,212 - 33,993,636	GRCz11
UCSC	2	-	GRCv10

Mapped Clones containing ptch2
CH211-226H23	Chr: 2 Details

PHYSICAL MAPPING

Feature	Chr	Position	Assembly	Citations
au1	2	33,983,412	GRCz11	Lee et al., 2012
hu1602	2	33,978,923	GRCz11	Koudijs et al., 2008
sa19807	2	33,983,706	GRCz11	Busch-Nentwich et al., 2013
	2	34,000,488	GRCz10	Busch-Nentwich et al., 2013
	2	33,701,581	Zv9	Busch-Nentwich et al., 2013
sa38340	2	33,978,752	GRCz11	Busch-Nentwich et al., 2013
	2	33,995,534	GRCz10	Busch-Nentwich et al., 2013
	2	33,696,627	Zv9	Busch-Nentwich et al., 2013
sa39869	2	33,969,523	GRCz11	Busch-Nentwich et al., 2013
	2	33,986,305	GRCz10	Busch-Nentwich et al., 2013
	2	33,687,398	Zv9	Busch-Nentwich et al., 2013
sa44536	2	33,975,270	GRCz11	Busch-Nentwich et al., 2013
	2	33,992,052	GRCz10	Busch-Nentwich et al., 2013
	2	33,693,145	Zv9	Busch-Nentwich et al., 2013
la010757Tg	2	33,702,299 - 33,702,309	Zv9
la014919Tg	2	33,706,998 - 33,707,008	Zv9
la028797Tg	2	33,710,614 - 33,710,624	Zv9

GENETIC MAPPING PANELS
Chr	Location	Mapped As	Panel	Mapped By	Scoring
2	129.9 cM	ptc1	Mother of Pearl (MOP)	Postlethwait, John H.	Data
2	433.54 cR	ptc1	Loeb/NIH/5000/4000 (LN54)	Dawid, Igor B.	Data
2	2851.0 cR	ptc1	Goodfellow T51 (T51)	Geisler, Robert	Data
2	89.7 cM	ptc1	Heat Shock (HS)	Woods, Ian G.	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS
Marker	Type	Chr	Distance	Publication / Person	Comments
z8451	SSLP	2		Lee et al., 2008	Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ...
z11410	SSLP	2		Lee et al., 2008	Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ...
z13521	SSLP	2		Lee et al., 2008	Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ...
z7632	SSLP	2		Lee et al., 2008	Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ...
atp6v0b	GENE	2		Lee et al., 2008	Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that ...

Chr 2

Lee et al., 2008

Lee, et al. (2008. Dev. Biol. 319(1): 10-22.) reports linkage mapping that places the blowout ...

Genomic Feature tc294z is an allele of ptch2

Chr	Location	Mapped As	Panel	Mapped By	Scoring
2	50.5 cM	tc294z	Boston MGH Cross (MGH)	Geisler, Robert	Data

Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

Primer Sets:
Strain	Bandsize	Restriction Enzyme	Annealing Temperature [C]
SJD	480		36.0
Forward Primer	AGCAAGGAGCTACGCTACAC
Reverse Primer	GCAGGGGAAAAGCTTATCAA

Genomic Feature sa19807 is an allele of ptch2