ZFIN ID: ZDB-GENE-980526-290 |
Gene Name: | homeobox B1b |
---|---|
Symbol: | hoxb1b |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing hoxb1b | |
---|---|
BUSM1-227H09 | Chr: 12 Details |
DKEY-11C5 | Chr: 12 Details |
PHYSICAL MAPPING
Feature | Chr | Position | Assembly | Citations |
---|---|---|---|---|
b1219 | 12 | 27,141,787 | GRCz11 | Miller et al., 2013 |
um195 | 12 | 27,141,734 - 27,141,741 | GRCz11 | Weicksel et al., 2014 |
um196 | 12 | 27,141,736 - 27,141,741 | GRCz11 | Weicksel et al., 2014 |
um197 | 12 | 27,141,724 - 27,141,740 | GRCz11 | Weicksel et al., 2014 |
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
12 | 226.68 cR | hoxa1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
12 | 3414.0 cR | hoxb1b | Goodfellow T51 (T51) | Geisler, Robert | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
hoxb8b | GENE | 12 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12. | |
hoxb6b | GENE | 12 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12. | |
hoxb5b | GENE | 12 | Amores et al., 1998 | Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report hoxb8b, hoxb6b, hoxb5b, and hoxb1b are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG12. | |
mir10a | MIRNAG | 12 | Woltering et al., 2006 | Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b. | |
hoxb5b | GENE | 12 | Woltering et al., 2006 | Woltering and Durston (2006, Nat. Genet. 38(6):601-602) have mapped mirn10a between hoxb1b and hoxb5b. |
|
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 693 | AluI | 36.0 |
Forward Primer | GACAGTGACAGCGACTCCAA | ||
Reverse Primer | TAATTGACCGGACGACAACA |
Genomic Feature hoxb1b_unrecovered is an allele of hoxb1b |