ZFIN ID: ZDB-ALT-980520-28
Genomic Feature: m808
Synonyms: tfu (1), tof (1), too few (1)
Affected Genomic Regions: fezf2
Type: Point Mutation (1)
Protocol: adult males treated with ENU
Lab Of Origin: Driever Lab
Location: Chr 11: 20058161 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A in Exon 2 (1)
Transcript Consequence: Missense (1)
Protein Consequence: Amino Acid Substitution: Cys>Ser at position 287 (1)
FLANKING SEQUENCE (GENOMIC)
TACCTGGACTCTGCTTATCAGTCTGAGCTGCTGAGTGGACATTTATTTTCTTCGGCAATCGCGAACTCTCAAGCACAAGCCATAAGCGCGCATCAGAAGCTCCTCTTGTTGGAGAACGCTAAACTTGCTTGCGTTTCTCCTGAGAAATTTCCCACACCTCAGTACCCACATAAAGAGCATCTGCCCGGGCAACTGGACCAAATCGTGCGGGAGAGCCACAACCTGACGGAGAAGAATGGAGTGAAAGCGCACAGCAAGACGAATAACTGCTCTTCAGACGGGAAACCCAAGAACTTCACGTGTGAAGTTTGTGGAAAGGTAAATTGAAGGATTCTGAAATGGTTTTGACGGGATGTGGGAAAAGTAAAATAGTACACAAATTGCTGATTATTTAGGCCTATTAAGCAGTTTCTATTCTTTTAAAGGTCTTCAACGCGCACTATAACCTCACTCGCCACATGCCGGTACACACAGGAGCGCGGCCGTTCGTGTGTAAAGTA
T/A
GCGGGAAAGGTTTCCGACAAGCCAGCACGTTGTGTAGACATAAAATTATTCACACACAGGTAGGTTAAAATATATATGTATAAACACTAAAAAATTTTAATTTTAATAAAATGCTCTCAAGTGATTAATTGTGTTTACAGGAGAAACCTCACAAGTGTAACCAGTGTGGAAAAGCTTTCAACAGAAGCTCTACGTTAAACACACACATCCGAATTCATGCGGGATACAAACCATTCGTCTGCGAATTTTGTGGAAAGGGTTTTCATCAAAAAGGTAAAACTTTTTTATATATATATTTTAAAATATGTAACCTATTTGTTGTGTATAGGCCAACAGATTAAATAACGTGCTCAATTTCATTGTATCATTGTTAGTTGCTGAAACAAGGTAACCAATTTTAAACGATTAATTAGTATCTCTACTAACTACTTACCATTGTATTTTACATTTTATACGGGTCAAAACACAGACCTTTACCTCCTTTGTACGTCGACAGTTCT
OTHER m808 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous fezf2m808/m808 fezf2 ♀+/- ♂+/-
fezf2m808/m808 fezf2 Unknown
fezf2m808/m808 (AB) fezf2 ♀-/- ♂-/-
Heterozygous fezf2m808/+ fezf2 Unknown
fezf2m808/+ fezf2 ♀+/- ♂+/-
Complex fezf2m808/+; s2503Tg fezf2
fezf2m808/+; s2506Tg fezf2
fezf2m808/m808; s2503Tg fezf2
fezf2m808/m808; s2506Tg fezf2

CITATIONS  (15)