ZFIN ID: ZDB-ALT-980520-24
Genomic Feature: m807
Synonyms:
Affected Genomic Regions: med12
Type: Small Deletion (1)
Protocol: adult males treated with ENU
Lab Of Origin: Driever Lab
Location: Chr 14: 23594156 - 23594157 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 2 bp deleted at position 109 (1)
Transcript Consequence: Frameshift (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
TTTGTGATTTCCCCCTATATGGAAAACTTTTTTCTTTTTTTTTTTTAAATAACGTATCCATTAAAATGACGATCATAATACAAAATTTATTAGGTAGGTTACGAAATATCAGTTTCATGGCTCTCATTTAGGACTTTTATCATTTTCAGAAGTTTATATTAAATACACTTGTCATTAATAATAAAATATACAGTTAGCCACAATATAAATATAACGATATCCTAAAATAAACATTAAAATCCTTTTTTTTTTTTTTAAAAGAAGCTGTTGTACTTAAAGGACTTTTATGTTGTCATGAATTTTCCCATCATCCCCGTCTGAGCGGAAGCATCGGTGAAGCAGCGGAGCTCTAGCCGCAGCAGTAGCGCTCAGGATCGGCTACACACCGGGCTGACATGCCGCGGGGATGATGGCTGCCTTCGGCGTTCTGAGCTACGAACACAGGCCTCTTAAACGGCCAAGACTCGGTCCTCCGGACGTTTATCCACAGGACCCGAAGC
AA/-
AAAGAGGTCGGACGACTTTCCTTCTTTCTCTCTAGCCACATTTCATTTGTAAATAATGAGCTAAACTGTGCTTTTCTGGGGCTGTTGAGATCAGGCCCTGCCCTCAGCTAACGGCCAATAACAATGAACCGAACGGCTCGATTAGCTGAACAGAAAAACATCATATTATTTCAGTCTTCGTCTTAGCTTGTTGTTGCAGATGGATAGAGAAAGATAAAGGTCGATTTATGATTGAAGCTCGGCTTTTAAAATGCCGGGAGCCTCTTTATTCATCGAGGTTTTAATTTAAAGCTGCTATCATCGTTAGAGTGCGATTTAAAATCGCTTTATGTGTAACAAATGACTGTTATTAATCATCATCTTGTGTTTTTAAGTGATTAAACGTTAGTATGTTGTAAATCTGTCTTGCTTTAAGATGTAAACAATCCCAATAGCCGCTTAGTTTTGTTGCGATGTGTAAGTTTGTTGACAACTGCTTGTGGATTGATGTGTTTGTCACG
Comment Citation
Wang et al., (2006) report that both the cDNA and genomic DNA from mot mutant  ... Wang et al., 2006
OTHER m807 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous med12m807/m807 med12 Unknown
med12m807/m807 med12 ♀+/- ♂+/-

CITATIONS  (9)