Genomic Feature

m347

ID
ZDB-ALT-980203-638
Name
m347
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Note
The mutation is a thymine to cytosine transversion (CTA->CCA) in codon 308, predicted to change leucine to proline (L308P).
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 10: 24728815 (GRCz11) (1) Details
Nucleotide change
A/G
Variant Notes
The mutation is a thymine to cytosine transversion (CTA->CCA) in codon 308,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Leu>Pro at position 308 (1)
Sequences
Flanking Sequence
TTACAATAATTTCTAAAGGATCATGTGATACCAAAGACTGCACTAATGATGCTTTGATTTACAGGAATAAACTACATTTTAAAACACATTTACATTCACAATGTATTCACAAAACGGTTATCTTAAATCATAATATTTCCCAGCATTGCTGTTTTTATGGCAGTTTTGATCAAATAAACAAGGCCTCTAAAAGCCAAAACTGTACTTTTACTATACTTCTGACAGGATGCACACAAATCTGTTTATAGAAAGTTTCTGTTACAGCAAATCAATTCCACATACCATGACAGCACAAACAAACATTGGACTTGTGTTTTGCAAATGCTGGTCTACAATGAGTAACTCATGTCCATAGTAATGAATCTAAAGCAAAGATCTTGATGAAACGGAAACTGAGACTGTGGAAAAAAGCAGTTGTAGAAACTGGGAGTTTTCTGTTCCTCACCATGACACTCTTGCTGTTGAGATAATGGCGGGGGATCATGGGCTCAAGAGTGTGT
A/G GGAAAGCCATTCCACAGGCAATGTCCAGAGCAAATTTCACAGCCTGGTTTTGATCCACTACTAAGTCTATATGAGCAAGAGAAAAAGAGGGAAATAGAGAAAAGACATTCAGTAAATAAATAAATAAACAAAAAATTTGCGTTAACAGCTTTGTTTCCCATTAAATAAGAAAATCTAATTGAACATAAACGGCATTAAAGACATAAAAAATGTTGTCTAATACTGAATAATTTATTTTTATAGATTTTAGTAAAACATTCAAGAGAAAAAAAATCTGAGAATTTACACGAATAACCTCACTTGAATAAACATATTTTATTAAATCATTTAATTTATGACTTTTTTTTTGTTATTTCAATAATTTATGATTAGTTATAAACTCCAAACATTAATACTAAAAAATAGTTTCAATCACCTTTGAAACATTAATTAAACGATAAGCAAAAAATAATCCTATTAAAATACTGAAATACAGTTAACCAATACAAGTAAATAAAAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations