Genomic Feature

m294

ID
ZDB-ALT-980203-609
Name
m294
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Note
A mutation in the second cysteine of the mature ligand region.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 12: 48211856 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
A mutation in the second cysteine of the mature ligand region.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>C (1)
Transcript Consequence
Missense (1)
Protein Consequence
Amino Acid Substitution: Cys>Arg (1)
Sequences
Flanking Sequence
TCCAGAATAGACCCCGGAGACCATCAGCAGCCCCTAAAGGACAGGAGCTCCAGAGCAGGCCCAGCAGACCAGCGACAGCTCCTAGGGGACAGGAGCTCCAGAGCGCACCCCAGCGGCCAGTAGTGGCCCCTGGGGGTCGGGAGATTCATAGCAGGCCCTGGTTGCCAGCAGCAACCCCTGGGGGACAGGAGATCCAGAATGGGACCCAGAAACACAGAGCCATGCTGCTGCTGTTTTCAGAGCAGCAGGACGGGGCCAGTCTCCTACACACCGCCGGGGCCTCGAAGTTTCTGTTTTCTAGAAATAAGAAAGAAGTCAAGCGAGGACGGGCCCTCAGGAGCCGCAGGGGCCGCCGGGGGCCACCTGTCAGGAGCCCAGAGCTGCAGAGAACACCACTGCACAAGAGCACCACCTGCAGGAGGGTGGACATGCATGTGGATTTTAACCAGATCGGATGGGGCTCCTGGATCGTGTTCCCTAAGAAGTACAATGCATACCGG
T/C GCGAGGGGGCCTGCCCGAACCCACTGGGAGAAGAGCTGCGGCCCACCAATCATGCATACATGCAGGTACTACGGTATATGTGTAAATATAACTTTAAATACATGGATAAATGTGTAAATGTTAATTATTTTAAATTAATCTGGCTTTCAATAAAATATAAGCTAATTAGCATTTTTAAAAGTAGATTTAAATAGTTTAAAATATTTATATTAAATATTTTGTAATGGCATAAAAATAGGTAGATAAGAATATAAATAATAATTGTTTGAAATAAAAGTTGCTTTAATTTAAATTTATATTAATTAGCATTTTTAACTGATGTGAAAAATTAAAGCTCAAAAATATTTATAATAAAACAACATAAATAAATGTAGAAATATTAAATAAAATGTAATTTCAAATAAATCTAAAACTATAAAACTAAAACTAATACAAGATTGTGTTACTATAATGTTATACAATTTATAGATAAGCATAAATTTATAAAATAAAAATTTATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations