Genomic Feature

m292

ID
ZDB-ALT-980203-606
Name
m292
Synonyms
  • bubble head (1)
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
spontaneous 
Lab of Origin
Driever Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 1: 46010352 (GRCz11) (1) Details
Nucleotide change
G/A
Variant Notes
The G to A transition in the splice donor site of exon 14 results in the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
G>A (1)
Transcript Consequence
Splice Site (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GAACAAATTAAACACTTGCATATTCGGCAAAATATTAAACTAGTAACACTTACAACAACATTTTTATAAATCTTAATTAATAAAAATTAAGTTTATTAAAACCTTTTTTAAAAATTATTAATAAATAATGAGTTTTAATGTTAATTTAAGATGAATAAATTCTGTAGAAGTTTTGTTCATTTTTGGTCAACCAAAGTTGTATGTTATGTACTTATCATAGTTATTACTTAAACTGGGTAATAACTAGGTAGTATCCCTAAACCTACACATTGAATTCAGTTTAACCCATGTATTTACTTGGTACTTTTTGGGGGTAAGTACATGTTAAGTAGTGTAAAATCAAAGCAAATAATGAAGGTGTTGCAAAATAGTGTAATTTAAGGGACAAGCAGACAGCTCATTGGTTGATTTATGTACACAGGGGAAGCTTCCTCTGACAGGAATGTCTGTGAGTAAAACAGAGGACAGCGATGGCACAAAACATGCTTTCGAAATATCTG
G/A TGAGTTTTCCAGACAGTTGTTTTTTATTTGATGTGAGCTATTATTGCTAGACGTTGATGTGCTTCAGCTATAATAATTATATTTGTGCAGGAAATATGATCGAGCGGATCCAGGTGATCTGTAATAATCAACAAGATCTTCAGGACTGGGTGGATCATCTACACCGGCAGACCAAACGCATTTCAACCAGCAGCTTGAAACCACAGAGTGTGCCCTGCCATACAGTGAGAAACACTTTTGTTTTCATCAATATAATAACAAAATTGATGTAATTAAAACCTGTGATGGTAAATTAGAATTGTTATCAGACATCACTTAAGACTTTGAAATTACACAAGTAGGCCTGTCATGTTAAGTAATTTTGTTGTGTCATAGAAATGATTGCGATAAGTGTTATTGTTGTCATTTTAAGACCAATTGATGTATGTTTATATAGCGATTAAACAACAGCATATAAATAGTCATAAACACATTCAAGGGACAAAAACAACATATAAATG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations