Genomic Feature

m201

ID
ZDB-ALT-980203-523
Name
m201
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Note
mutation results in an incomplete PTB domain.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 20: 18786775 (GRCz11) (1) Details
Nucleotide change
G/T
Variant Notes
mutation results in an incomplete PTB domain.
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
C>A in Exon 4 (1)
Transcript Consequence
Premature Stop (1)
Protein Consequence
Polypeptide Truncation: Tyr>Stop (1)
Sequences
Flanking Sequence
ACTGTTCTTTGAGGCAGACCAAACATTTCAAAAGATGTGAATTATGCAAATTTGTAACATGTATGGTGCTTTTCAGATTTACACAAGTGTAAAAATCTAAAAAGGCCAAAATAGGCACCCTTAGAATGACAAAAGCTAACCTTGTTGTCAACAGCCAGCACAAGCAGACAGCAGACCTCCACCAGCACAGCCCCACTCTCAGATAGAGAGCTCAGAGTGGGAGATTTCGACATCTCTGTACTATGACATGGGGAACCTCCGGGCTCCTGAGCTGCAAACACAAATTATACAAACCTTTACATATTTTTCACATATTTCACTCTAAATCTTGAACCCACTGTGTTTAATTTAATGCTCATTAATTGACCTCATTACCGTATACCTGTTTTTAGCACCACTAGATGAAGCGAGTCGTCTCTGATGTAGGACACAGCTGCAATGTCGTGGATGGGTACGCGCAGAATGATGTCCTCTCCATCACGCCACACAAGCTTCACATT
G/T TACGCTGATAAACTGACAACAGCATCCTGCTCTGAGGTCAGCTGCCCAGCCAACTGATGAGACTTCTGCACAAGATATAAGAGAACCAATGTGAAAACATATCCTCATGTTGCAAAATAAAACAGTTTATGAGTATCGAGCTTACCCTGGCATTGTCAATGAGCTGCAGAACTTCAGTGCGGCTGGAGGGATTCAGGTATCCAGGAACTGAGGTCAGCTGTCCCAGATACTACAACAATAATAACAATGTTATTAATTATAGAGCCTTCCTAGAATACAATTGAGCACAGTTAACAAGAAAATAATATTAAAAACAAAATATTAATTTATAAATAATCACAAAAAAATACAGGGCACATTAAAAGATTGCATCAACATCCAGGGGAGAAGTACTGAATAACTAGCTATGGGAGGGATCACAGAAGTGGATATAGATTTGGGTATCGGCAGCATAACAGTGGAATTTAGGGATGTAACTGATCACGGTTGATCCATAATCC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations