Genomic Feature

m169

ID
ZDB-ALT-980203-500
Name
m169
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Zebrafish International Resource Center (ZIRC)    (order this)
Other Pages
Note
Mutation in intron generates a proximal splice acceptor site, resulting in a 17-bp insertion, which causes a frameshift and premature stop after the addition of 62 incorrect amino acids.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 14: 26475531 (GRCz11) (1) Details
Nucleotide change
A/T
Variant Notes
Mutation in intron generates a proximal splice acceptor site, resulting in a  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>A (1)
Transcript Consequence
Cryptic Acceptor Splice Site, Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CCACTGGATGTACAGTGTTTGCCTACACTGCCTATGCCACGAGCTGGCCCCGAGTTGGCTCCTGAGTGTTGTAAATACGGGCGCTCACCTCCCTCTCAACAGAGCGTGTAGGTGATAAATGACATCAGTACATAATAACCGGTTATGATTATTACTAAACCGATACTGAATTGTCTGCGTCTGCATCGTGGTGCACCGAAAAAACTATCAATTTTGACTGTCCTATTCAATACATTGCGTGTCAGTCTTATTTTATTATATTATTAATTATATATGTATAATTTTAACTAATAATTTAATAAATTTTTTTTGTATTTTGGGGGAATCACTTGGATCACTTTTGAATGGGTTGTTCGTTAAAAGTTTCTTACCCCCTCTGGGCATGTTCTGAGGAGCCAGGCTGCTACCAGTCTCCATGGACTGAGAACCGTCTTGCCCCATCTGTTCATCTGGAGGCATGTAGGCAGGAGGAGGAGTATCAGCTGGTAAAAAGACATCAC
A/T GAGAAAAAGAGAGAGAAAATGAGTCAGATGATCAGGTCTGCTGCAAACAAATGGGCTTCCACTGCAATCCCCTGGAGCCTTCTTTCTGATGATTCTTTACAGGAAGCTGCTTCACATCTTATGGAAACCTTTTAGTGTCAGATTTCACAACTCCTTTACATGAAATGCCCACCTCAGTACAGTCATACAGATAAAGATAATGAAGATCTGAATGCAAATGACAAAAACTATTAAAACAAGGACCTTATTGATTGTGGTATCATCTGCCAAAGTGTGAATTAGACATAGCACAGATGTTTGATATTTGGATAAACATATGAAGTACTTTGACTCCAAGAAGTTCTCCTATAAACAGCTACTAAATGTCCCACAGAACAGCAAATTATATTAGAATTTATAGCTAATAAAATAAAGCAGGTTAAAAAATGCTTTTGGCAAAAATTCCTAGAAGAAAAATATAAAAGGGTTTGTTAAATTAATCTTACTACTTCCAGACAAAT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
m169.pdf
Citations