Genomic Feature

m780

ID
ZDB-ALT-980203-446
Name
m780
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
adult males treated with ENU
Lab of Origin
Driever Lab
Current Source
Other Pages
Note
The m610 and m780 alleles are likely re-isolates of the same mutational event. Both have a point mutation in the splice acceptor at the 5' end of exon 7 resulting in the use of a cryptic splice acceptor 14 bp further 3', which causes a frame shift and truncation at amino acid 395.
The m610 and m780 alleles are likely re-isolates of the same mutational event. Both have a point mutation in the splice acceptor at the 5' end of exon 7 resulting in the use of a cryptic splice acceptor 14 bp further 3', which causes a frame shift and truncation at amino acid 395.
Genome Browser
>
Variants
Variant Type
Point Mutation
Variant Location
Chr 24: 8723081 (GRCz11) (1) Details
Nucleotide change
T/C
Variant Notes
The m610 and m780 alleles are likely re-isolates of the same mutational event.  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
A>G (1)
Transcript Consequence
Cryptic Acceptor Splice Site, Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
GGCAGATCTGTACTCCTTTCATTGGCACACTGCTTTACTGATTTAGAGAAGTGCATTGTCCGCAAATCCCAGAATTAACTGTGTGTTTTATTAATTAAAAAAAAACTAAATGCCAAGATCGGAAGGTGGTGGGTTCAGTGTTTCATCTTGATCACTAGTGTGTTTGTTATATGTAGTTTGTCATATTAGTTGGGAGGTGGTGGTTGGATATCACTTTCTGTGCTTCTCATCTTTGTCACCCGCTTTCGACCCCGTCTCACTGTGGCTGTTGGGATTGTTGTTCAGGTACATTTTGTCCATTGCTTTAATTGCCTCCGTCAGATAGTTCTGCAGAGCTGTGAGGGCCGCACAGACGGCCGGAGTTCCGAATCCGTGAGAAATAAGACTGAAGTGGGTCAAACAGCTCTGAATCCCGGGCTCGAGAATGGGTTGTGGACGTGAATTCCCCAAGGGCGAGCGGTCTTGAGACAGCAGGTCCGTGAACTCTTTGCAGATTTGTC
T/C AGAAGGAGACACAATGCAGGATGCGTGTCAGGAGGAAGCTAATTACAGCTGATGCTATGACGTCATACATGTATTAGTAAGACTATGTGGTCCATATGTGTCCTTTAATCGATGACACACGTATTCCGTTTGACAGTAGCTGGATGGGCAGTGTCGTGTCATAGCGATGGACAATTCACGTTCAGCTTAAGAGAGCCGCATCTATGTCAGAAACGGATGAGGGAGTCGTCTTGTATGTTTTTATTCTAAATCGTTGTTGTTTGCAGTCTTATGTGTTTTAATTGACACTGGTGCTGATCTTTTTTATTTAAACTTTTTTTTTTTTTATTGCATCAAATATGCCGATATATTTCATTGCAGAAAGCATACCGTTTCGTGGAATATTTGAAATATACTTCATAAAACCAAACGGCTCCAAAAAGCAGGAATTAAACCAGCTCTGTTTATTAAAATCTAAATGTAACAAATTTTTAGTACACGTATAGGCGATCCAGCATAAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations